| Antibodies |
|
| Rpb1 NTD (D8L4Y) antibody |
Cell Signaling Tech. |
Cat# 14958; RRID:AB_2687876
|
| Rabbit monoclonal antibody against Topoisomerase II Alpha (Topo IIa)(EP1102Y) |
Abcam |
Cat# ab52934; RRID:AB_2240762
|
| Anti-Topo IIalpha (F-12) antibody |
Santa Cruz Biotech. |
Cat# sc-365916; RRID:AB_10842059
|
| TOP2B antibody |
Proteintech |
Cat# 20549-1-AP; RRID:AB_10700004
|
| Topoisomerase I antibody - ChIP Grade |
Abcam |
Cat# ab3825; RRID:AB_304095
|
| Topoisomerase I antibody [EPR5375] |
Abcam |
Cat# ab109374; RRID:AB_10861978
|
| Anti-p38 MAPK, phospho (Thr180 / Tyr182) Antibody, Unconjugated |
Cell Signaling Tech. |
Cat# 9211; RRID:AB_331641
|
| Anti-α-Tubulin antibody |
Sigma-Aldrich |
Cat# T9026; RRID:AB_477593
|
| Mouse Anti-Histone H2A.X, phospho (Ser139) Monoclonal antibody, Unconjugated, Clone jbw301 |
Millipore |
Cat# 05-636; RRID:AB_309864
|
| Rabbit Anti-Histone H3, phospho (Ser10) Mitosismarker Polyclonal antibody, Unconjugated |
Millipore |
Cat# 06-570; RRID:AB_310177
|
| NELF-E (H-140) antibody |
Santa Cruz Biotech. |
Cat# sc-32912; RRID:AB_2177858
|
|
| Bacterial and virus strains |
|
|
e. coli: stbl3 competent cells |
This paper |
N/A |
|
e. coli: DH5α competent cells |
This paper |
N/A |
|
| Chemicals, peptides, and recombinant proteins |
|
| EZ-Link Psoralen-PEG3-Biotin |
Thermo Fisher |
Cat# 29986 |
| Digitonin |
Sigma-Aldrich |
Cat# D141 |
| Tn5A Enzyme |
CABD |
N/A |
| s.p. Cas9 Nuclease 3NLS |
Integrated DNA Tech. |
Cat# 1074181 |
| Merbarone |
Sigma-Aldrich |
Cat# M2070 |
| Etoposide |
Sigma-Aldrich |
Cat# E1383 |
| ICRF-187 |
Sigma-Aldrich |
Cat# D1446 |
| Camptothecin |
Sigma-Aldrich |
Cat# C9911 |
| Triptolide |
Sigma-Aldrich |
Cat#T3652 |
|
| Critical commercial assays |
|
| DuoLink PLA Kit |
Sigma-Aldrich |
Cat# DUO92008100RXN |
| RNeasy KIT |
QIAGEN |
Cat# 74106 |
| TruSeq Stranded mRNA |
lllumina |
Cat# 20020594 |
|
| Deposited data |
|
| RNA sequencing Data |
This paper |
GEO: GSE141800
|
| ChIP-seq data of TOP2A |
This paper |
GEO: GSE141800
|
| ChIP-seq data of POL2 |
This paper |
GEO: GSE141800
|
| CTCF ChIP-seq |
ENCODE Project Consortium, 2012 |
https://www.encodeproject.org/experiments/ENCSR000DVI/ |
| H3K4me3 ChIP-seq |
ENCODE Project Consortium, 2012 |
https://www.encodeproject.org/experiments/ENCSR000DVK/ |
| H3K27ac ChIP-seq |
Sánchez et al., 2018 |
https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM2865066 |
| Human reference genome, NCBI build 37, GRCh37/hg19 |
Genome Reference Consortium |
https://www.ncbi.nlm.nih.gov/grc/human |
| Unprocessed and uncompressed imaging data (microscopy and blots) |
This paper |
Mendeley Data at: http://dx.doi.org/10.17632/r69w5y36w2.1
|
|
| Experimental models: Cell lines |
|
| hTERT-RPE-1 cells |
ATCC |
CRL-4000 |
| Cas9-overexpressing hTERT RPE-1 |
Kindly provided byDr. Durocher Lab |
N/A |
| A549 |
ATCC |
CCL-185 |
| HEK293T |
ATCC |
CRL-1573 |
| U2OS |
ATCC |
HTB-96 |
| Mouse Embryonic Fibroblast (MEFs) |
This paper |
N/A |
|
| Oligonucleotides |
|
| Primers for qPCR, see Table S1
|
This paper |
N/A |
| siRNA targeting sequence: NELFE: GGCAUUGCUGGCUCUGAAGUU |
Aiyar et al., 2004 |
N/A |
| siRNA targeting sequence: LUC: CGUACGCGGAAUACUUCGA |
Jimeno-González et al., 2015 |
N/A |
| CRISPR-Cas9 tracrRNA |
Integrated DNA Tech. |
Cat# 1072532 |
| crRNAs targeting sequence: TOP2A:CTCCGCCCAGACACCTACAT |
This paper |
N/A |
| crRNAs targeting sequence:TOP2B: CTTCGTCCTGATACATATAT |
This paper |
N/A |
| crRNAs targeting sequence: TDP2:CTTGCTGAGTATCTTCAGAT |
This paper |
N/A |
| crRNAs targeting sequence: FOS 1#:ACTAGCACTGTTCCTGCGTT |
This paper |
N/A |
| crRNAs targeting sequence: FOS 2#:CCCTAATTCAGTGCAAAGCG |
This paper |
N/A |
| crRNAs targeting sequence: Non-targeting |
Integrated DNA Tech. |
Cat# 1072544 |
|
| Recombinant DNA |
|
| lentiCas9n(D10A)-Blast plasmid |
Sanjana et al., 2014 |
Addgene Plasmid #63593 |
|
| Software and algorithms |
|
| GraphPad Prism 8 |
GraphPad |
N/A |
| R version 3.5.0 |
R Core Team, 2018 |
https://www.R-project.org/ |
| FASTQC |
Andrews, 2010 |
https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
| Bowtie version 1.2.0 |
Langmead et al., 2009 |
http://bowtie-bio.sourceforge.net/index.shtml |
| MACS2 version 2.1 |
Zhang et al., 2008 |
https://github.com/macs3-project/MACS |
| DESeq2 |
Love et al., 2014 |
https://bioconductor.org/packages/release/bioc/html/DESeq2.html |