Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jun 1.
Published in final edited form as: J Comp Neurol. 2021 Jan 7;529(9):2362–2375. doi: 10.1002/cne.25100

Defining VDR expression in the brain using a novel VDRCre mouse

Hailan Liu a,b,1, Yang He a,1, Jessie Beck a, Silvania da Silva Teixeira a,2, Keisha Harrison a,3, Yong Xu a, Stephanie Sisley a
PMCID: PMC8053677  NIHMSID: NIHMS1657158  PMID: 33368246

Abstract

Vitamin D action has been linked to several diseases regulated by the brain including obesity, diabetes, autism, and Parkinson’s. However, the location of the vitamin D receptor (VDR) in the brain is not clear due to conflicting reports. We found that two antibodies previously published as specific in peripheral tissues are not specific in the brain. We thus created a new knockin mouse with cre recombinase expression under the control of the endogenous VDR promoter (VDRCre). We demonstrated that the cre activity in the VDRCre mouse brain (as reported by a cre-dependent tdTomato expression) is highly overlapping with endogenous VDR mRNAs. These VDR-expressing cells were enriched in multiple brain regions including the cortex, amygdala, caudate putamen, and hypothalamus among others. In the hypothalamus, VDR partially colocalized with vasopressin, oxytocin, estrogen receptor α, and β-endorphin to various degrees. We further functionally validated our model by demonstrating that the endogenous VDR agonist 1,25-dihydroxyvitamin D activated all tested tdTomato+ neurons in the paraventricular hypothalamus but had no effect on neurons without tdTomato fluorescence. Thus, we have generated a new mouse tool that allows us to visualize VDR-expressing cells and to characterize their functions.

Keywords: Mutant mouse strain, Brain, Vitamin D receptor, Immunohistochemistry, RRID:AB_628040, RRID:AB_632069, RRID:AB_141637, RRID:AB_2832252, RRID:AB_2715552, RRID:AB_2157629, RRID:AB_310305, RRID:AB_2314007

Graphical Abstract

We generated a novel vitamin D receptor (VDR) VDRCre knockin mouse for the interrogation of VDR anatomy in the brain. In this paper, we demonstrate through immunohistochemistry that VDRCre-driven reporter expression colocalizes with VDR mRNA throughout the brain. Additionally, we demonstrate that tdTomato (+) neurons respond rapidly to vitamin D, which does not occur in tdTomato (−) neurons.

graphic file with name nihms-1657158-f0007.jpg

1. Introduction

Vitamin D is a well-known important nutritional factor impacting calcium levels and bone health. Low vitamin D levels have been linked to obesity and diabetes, although the cause is not clear. Although there is some evidence that low vitamin D levels can affect glucose levels through peripheral actions, we have previously shown that vitamin D can act directly in the brain to improve glucose tolerance (Sisley et al., 2016). Additionally, we have shown that the loss of vitamin D receptors (VDR) within the paraventricular nucleus of the brain impairs glucose tolerance in male mice (Sisley et al., 2016). While the link between vitamin D action in the brain and diabetes is new for the diabetes field, in fact there are several neurological disorders that have also been linked to low vitamin D levels. For instance, multiple sclerosis, autism, and Parkinson’s (Fernandes de Abreu et al., 2009; Holmøy & Moen, 2010; Kaneko et al., 2015; Patrick & Ames, 2014) all have associations with low vitamin D concentrations.

How vitamin D acts in the brain is not well established. Vitamin D has known genomic and non-genomic actions within the brain (Xiaoying Cui et al., 2017). A key aspect of determining mechanism is to understand the location and cell types where VDR are located. Unfortunately, there is considerable discrepancy in the literature regarding the location of VDR within the brain and very little is known about the cell types in the brain that contain the VDR.

Several different antibodies for the VDR have been used in immunohistochemistry experiments, with conflicting results. VDR staining occurs in multiple areas of the brain including the cortex, bed nucleus of the stria terminalis, amygdala, hippocampus, and hypothalamus with the 9A7 antibody in both mouse and human brains (Prüfer et al., 1999; Smolders et al., 2013). However, another group showed that the 9A7 antibody lacks specificity in the duodenum at high concentrations (Y. Wang et al., 2010). This group identified a more specific antibody (D-6, Santa Cruz) which provided specific staining for the VDR in kidney and duodenum. With the D-6 antibody, no staining of the VDR is visualized in the brain (Y. Wang et al., 2012) which conflicted with multiple lines of data showing likely VDR expression in the brain through autoradiography, in situ hybridization and RT-PCR (Landel et al., 2017; Smolders et al., 2013; Stumpf & O’Brien, 1987; Taniura et al., 2006). Confusing matters even further, a third group showed diffuse, non-nuclear staining of neurons with the D-6 antibody but nuclear localization with the N-20 antibody (Santa Cruz) (X Cui et al., 2013). Interestingly, no group has determined the specificity of known VDR antibodies utilizing immunohistochemistry of brain slices in known VDR-null animals.

In this study, we sought to determine the expression of the VDR within the brain. We show the lack of specificity of two available, and widely used, VDR commercial antibodies and report the generation of a new knockin mouse line, VDRCre, for the identification of the VDR within the mouse brain. Together, these results demonstrate the usefulness of a novel mouse, VDRCre, to identify and interrogate the VDR-positive neuronal populations within the brain.

2. Materials and Methods

2.1. Animals:

Animals were group housed at Baylor College of Medicine (BCM) on a 12 hour light/dark cycle with ad libitum access to water and food. Studies used either adult VDR-null mice (DeMay, #006133, Jackson Laboratories), VDRCre mice (see more below), or their wildtype littermates. For expression of VDR in VDRCre mice, we also used a TdTomato reporter mouse (Ai14; B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J, #007914, Jackson Laboratory). Animal numbers are stated in the figure legends. All studies were approved by the BCM Institutional Animal Care and Use Committee (IACUC). VDR-null mice were kept on a rescue diet containing 20% lactose, 2% calcium, and 1.25% phosphorus (TD.96348, Envigo). All other mice were on chow diet.

2.2. Generation of VDRCre mouse:

CRISPR-mediated knockin allele design. Single guide RNAs (sgRNAs) were selected by the BCM Mouse Embryonic Stem Cell core (BCM mES Core) using the Wellcome Trust Sanger Institute Genome Editing website. Two sgRNAs were chosen that had no fewer than three mismatches, and flanked the native translational stop site of VDR (5’ sgRNA: http://www.sanger.ac.uk/htgt/wge/crispr/392689904 and 3’ sgRNA: http://www.sanger.ac.uk/htgt/wge/crispr/392689872). The BCM mES core designed a long, single stranded donor DNA (lssDNA) with ~100 base homology arms to insert a V5 tag with a GGGGS Linker followed by a P2A sequence and Cre-recombinase on the C-terminal end of the VDR gene.

SgRNA and Cas9 mRNA preparation: Single guide RNAs (sgRNAs) were synthesized by the BCM mES Core using DNA templates for in vitro transcription. DNA templates were produced using overlapping oligonucleotides in a high-fidelity PCR reaction (Bassett et al., 2013). The PCR products were first purified using the QiaQuick PCR purification kit and used as a template for in vitro transcription of the sgRNA with the MEGAshort script T7 kit (ThermoFisher, AM1354). Following in vitro transcription, RNA was purified using the MEGAclear Transcription Clean-Up Kit (ThermoFisher, AM1908). All samples were analyzed by Nanodrop to determine concentration and visualized using the Qiaxcel Advanced System using the RNA QC V2.0 kit to check the quality of RNA product before storage at −80°C. Cas9 mRNA was purchased from ThermoFisher (A25640). All sgRNAs were reanalyzed by Nanodrop prior to assembling the microinjection mixtures.

LssDNA donor production: The repair template for microinjection was generated by the BCM mES Core using an adapted protocol from (Lim et al., 2012), generously provided by Lauryl Nutter (unpublished communication). Briefly, a custom double-stranded DNA template was purchased as a gBlock® from Integrated DNA Technologies (Coralville, IA). Primers were purchased from Sigma-Aldrich to amplify the DNA template, such that a 5’-phosphate group was added to the forward primer. Amplification was performed using Q5® High-Fidelity DNA polymerase (New England Biolabs, M0491S) to produce amplicons for digest with lambda exonuclease, which preferentially degrades a 5’-phosphorylated DNA strand. The remaining antisense strand was cleaned up using the Monarch® PCR & DNA Cleanup Kit (New England Biolabs, T1030S), analyzed by Nanodrop, and checked for purity on a denaturing gel prior to microinjection. KI allele attempts using lssDNA donors consisted of 100ng/μL Cas9 mRNA, 20 ng/μL sgRNA (each), and 50ng/μL lssDNA in a final volume of 60 μL 1xPBS (RNAse-free).

Microinjection of CRISPR/Cas9 reagents: C57BL/6NJ female mice, 24 to 32 days old, were injected with 5 IU/mouse of pregnant mare serum, followed 46.5 hr later with 5 IU/mouse of human chorionic gonadotropin. The females were then mated to C57BL/6NJ males. Fertilized oocytes were collected at 0.5 dpc for microinjection. The BCM Genetically Engineered Mouse Core microinjected the sgRNA/Cas9/lssDNA mixture into the cytoplasm of at least 200 pronuclear stage zygotes. Injected zygotes were transferred into pseudopregnant ICR females on the afternoon of the injection, approximately 25–32 zygotes per recipient female.

Progeny were genotyped with multiple sets of primers to verify correct targeting of the cre allele to the VDR gene (Table 1). Two animals which appeared to have a correctly targeted cre-allele were backcrossed to a wild-type C57Bl/6J mouse. A cre positive offspring of this cross then had confirmatory Sanger sequencing across the entire allele, which showed a 99% sequence match and confirmed the fidelity of the V5, P2A, and Cre sequences. This mouse was then mated with a tdTomato reporter mouse (Ai14; B6.Cg-Gt(ROSA)26Sortm14(CAGtdTomato)Hze/J, #007914, Jackson Laboratory). Progeny from this mating who contained correct genotyping for the cre-allele and the tdTomato allele are denoted as VDRCre; Ai14.

Table 1.

Genotyping primers for identification of VDRCre mice.

Identification on Fig. 2 Sequence Target Sequence
A VDR KI2 Forward CCTGTGTGGTGGATACTGTAA
F VDR KI2 Reverse ACAGCAGTGTCTCCTAACTGAG
D VDR-cre Forward GCGCTGGAGTTTCAATACCG
B VDR-V5 Reverse CGAGACCGAGGAGAGGGTTA
C Internal Cre Forward GCCAGCTAAACATGCTTCATC
E Internal Cre Reverse ATTGCCCCTGTTTCACTATC
Open in a new tab

2.3. Immunohistochemistry:

For VDR antibody specificity testing, dual immunohistochemistry was performed according to previously published protocols (Sisley et al., 2016) in male VDR-null and wild type littermates. Antibodies tested were: D-6 (#sc-13133, Santa Cruz Biotechnology, 1:500, RRID:AB_628040) and N-20 (1:100; #sc-1009, Santa Cruz Biotechnology, RRID:AB_632069). These were followed by either Alexa Fluor 594 (#A-21207, RRID:AB_141637, ThermoFisher Scientific) or 488 antibodies (#A-150133, RRID:AB_2832252, Abcam) as appropriate (1:200). Slides were coverslipped with vectashield hard-set mounting medium with DAPI (#101098-050, VWR). For colocalization experiments utilizing the VDRCre mouse, three male and three female VDRCre;Ai14 mice as well as one male and female littermate control (cre−, tdTomato+) were used with the following antibodies: arginine vasopressin (#H-065-07, RRID:AB_2715552, Phoenix Pharmaceuticals, 1:500), oxytocin (#AB911, RRID:AB_2157629, Millipore, 1:500), ERα (#06–935, RRID:AB_310305, Millipore, 1:5000), and β-endorphin (#H-022–33, RRID:AB_2314007, Phoenix Peptide, 1:5000). For quantification measurements, 4–8 slices of the each representative area from each mouse were counted using the National Institute of Health program, Image J (Schneider et al., 2012) and then averaged.

With regards to the specific primary antisera utilized in this manuscript, they were chosen based on publications previously validating their specificity. VDR D-6 was shown to be specific in intestine and kidney utilizing a VDR null mouse (Y. Wang et al., 2010). The N-20 antibody produced a single band on western blot, nuclear imunohistochemical staining and correlation between protein and RT-PCR data (X Cui et al., 2013). As described in Figure 1, though, we tested the specificity of VDR D-6 and N-20 antibodies in the brain using a VDR null model, and neither showed specificity. The specificity of ERα has been validated in brain tissue from a null animal (Cao et al., 2014). The specificity of the OXT antibody has been shown through co-localization of OXT immunoreactivity with OXT-Cre mediated GFP signal (Choe et al., 2015). The specificity of the AVP antibody has not been directly tested in tissue, but has shown excellent specificity from other neuropeptides per the manufacturer’s website (https://www.phoenixpeptide.com/products/view/Assay-Kits/RK-065–07). In tissue, it specifically stains non-oxytocin, non-corticotropin releasing factor (CRF) neurons (Ramot et al., 2017) and has expression patterns which mirror mRNA staining for vasopressin (Hrabovszky et al., 2004; Morita et al., 2001). The specificity of β-endorphin has been previously shown through negative staining by preabsorbed serum incubated in β-endorphin (Helwig et al., 2006). Our study showed, in line with the established knowledge, positive signals in the hypothalamus from were only detected in specific nuclei. Additional information on the antibodies utilized in this study is in Table 2.

Fig. 1.

Fig. 1.

Open in a new tab

Dual immunohistochemical staining for the VDR using different antibodies in the hypothalamus. a-d, Low (a) and high (b-d) magnification images of antibody staining in wild type animals with N-20 (b), D-6 (c), and merged image (d). e-h, Low (e) and high (f-h) magnification images of antibody staining in VDR-null animals with N-20 (f), D-6 (g), and merged image (h). (i) vdr gene expression in whole hypothalamic samples of VDR-null mice normalized to L32 in all samples. For all images, N-20 is green, D-6 is magenta, and DAPI is blue. Box area delineates area of higher magnification. Scale bars: 100 μm in widefield view (a, e) and 25 μm in higher magnification (b-d, f-h). 3V, third ventricle; ARH, arcuate hypothalamus; ME, median eminence; WT, wild type. * p < 0.05.

Table 2.

Key characteristics of primary antisera.

Antibody Host Immunogen Manufacturer Catalogue No. Dilution RRID
VDR (D-6) Mouse Amino acids 344424 of VDR of human origin Santa Cruz Biotechnology sc-13133 1:500 AB_628040
VDR (N-20) Rabbit N-terminus of VDR of rat origin Santa Cruz Biotechnology sc-1009 1:100 AB_632069
AVP Rabbit [Arg8]-vasopressin Phoenix Pharmaceuticals H-065-07 1:500 AB_2715552
OXT Rabbit Synthetic oxytocin (Sigma) conjugated to thyroglobulin Millipore AB911 1:500 AB_2157629
ERα Rabbit C-terminus of rat Estrogen Receptor alpha Millipore #06-935 1:5000 AB_310305
Endorphin (beta) Rabbit YGGFMTSEKSQTPL VTLFKNAIIKNVHKK GQ Phoenix Pharmaceuticals H-022-33 1:5000 AB_2314007
Open in a new tab

2.4. In situ hybridization (RNAscope):

Mice were anesthetized and perfused transcardially with 0.9% saline followed by 10% formalin. Brains were removed and post fixed in 10% formalin for 12 h at 4°C and cryoprotected in 30% sucrose for 48 hours. Brains were frozen, sectioned at 14 μm using the cryostat, washed in DEPC-treated phosphate buffered saline for 10 min. Sections were mounted on DEPC-treated charged slides, dried for 0.5 hour at room temperature and stored at −80°C. On the day of the RNAScope assay, the slides were thawed and rinsed 2 times in PBS 1X and then placed in an oven for 30 min at 60°C. After that, slides were post fixed in 10% formalin for 15 minutes at 4°C. Slides were then gradually dehydrated in ethanol (50, 70 and 100%, 5 min each) and underwent target retrieval for 5 minutes at 100°C. Slides were incubated in protease III (#322337, ACDBio) for 30 minutes at 40°C. Slides were then rinsed in distilled water and incubated in RNAscope probes for Vitamin D Receptor (Mm-vdr; #524511, ACDBio) and tdTomato (#317041-C3) for 2 hours at 40°C. Sections were then processed using the RNAscope Fluorescent Multiplex Detection Reagents (#320851, ACDBio) according to the manufacturer instructions. Slides were cover-slipped and analyzed using a fluorescence microscope.

2.5. Real-time qRT-PCR:

Real-time qRT-PCR was performed per previously described protocols (Sisley et al., 2016). Briefly, qPCR was performed using gene-specific TaqMan probes (Applied Biosystems) and master mix (Thermo Fischer Scientific) according to manufacturer’s protocols. For VDR expression in VDR-null mice, whole hypothalamus was used. For VDR and tomato expression in peripheral tissues, VDRCre;Ai14 or wild type mice were deeply anesthetized, decapitated, and duodenum (first 4 cm), liver (right lobe) and left kidney removed. RT-PCR was performed as per hypothalamus. VDR and tomato expression were normalized against the expression of house-keeping genes B2M and L32 for duodenum and kidney. Due to COVID-19 work/ordering restrictions, liver had to be normalized against GAPDH and B2M. We verified that there was no difference in expression levels when normalized to L32 in a few samples. Since VDR expression is low in the liver, a Ct count of 40 was used for any sample where VDR was not detected. qPCR primers used were as follows: Mm00777741_sH (Mrpl32), Mm01315604_m1 (VDR), Mm99999915_g1 (Gapdh), Mm00437762_m1 (B2m), Mm07319439_mr (tdTomato).

Real-time RT-PCR in tomato+ or tomato− cells: After deep anesthesia, VDRCre;Ai14 mice were decapitated and the mice brain was removed and immediately submerged in ice-cold sucrose-based cutting solution (adjusted to pH 7.3) containing (in mM) 10 NaCl, 25 NaHCO3, 195 Sucrose, 5 Glucose, 2.5 KCl, 1.25 NaH2PO4, 2 Na-pyruvate, 0.5 CaCl2, and 7 MgCl2 bubbled continuously with 95% O2 and 5% CO2. The slices (250 μm) were cut with a Microm HM 650V vibratome (Thermo Scientific and recovered for 1h at 34°C) and then maintained at room temperature in artificial cerebrospinal fluid (aCSF, pH 7.3) containing 126mM NaCl, 2.5mM KCl, 2.4 mM CaCl2, 1.2mM NaH2PO4, 1.2mM MgCl2, 11.1mM glucose, and 21.4mM NaHCO3 saturated with 95% O2 and 5% CO2 before recording. Slices were transferred to a chamber, and tomato+ neurons were visualized using epifluorescence and IR-DIC imaging on an upright microscope equipped with a moveable stage (MP-285, Sutter Instrument). Single neurons from the hippocampus were manually picked up by the pipette and three to ten neurons were combined as a sample for RNA extraction and reverse transcription using the Ambion Single-Cell-to-CT Kit (Ambion, Life Technologies) according to the manufacturer’s instruction. Briefly, 30μl Single Cell Lysis solutions with DNase I was added to each sample, and the supernatant after centrifuge were used for cDNA synthesis (25°C for 10min, 42°C for 60min, and 85°C for 5min). The cDNA samples were amplified on a CFX384 RealTime System (Bio-Rad) using SsoADV SYBR Green Supermix (Bio-Rad). Results were normalized against the expression of house-keeping gene (β-actin). Primer sequences for β-actin and VDR: β-actin forward, ATGGAGGGGAATACAGCCC; β-actin reverse, TTCTTTGCAGCTCCTTCGTT; VDR forward, ATCAGGGAAAAGTTCACCACG; VDR reverse, AAGCTCTGTTACCTGGAACCC.

2.6. Electrophysiology:

Electrophysiology recordings were performed as previously described (Saito et al., 2016; Yang et al., 2019). Briefly, 2 male and 2 female VDRCre;Ai14 mice were anesthetized with isoflurane and brains were dissected rapidly and immersed in ice-cold and oxygenated cutting solutions (in mM: 10 NaCl, 195 Sucrose, 2.5 KCl, 1.25 NaH2PO4, 7 MgCl2, 25 NaHCO3, 5 glucose, 0.5 CaCl2, 2 sodium pyruvate. balanced with 95% O2/ 5% CO2). Coronal brain slices (220 μm) containing the PVH were cut with a Microm HM 650 V vibratome (Thermo Scientific) in oxygenated cutting solution. Slices were then incubated in oxygenated artificial cerebrospinal fluid (aCSF) (in mM: 126 NaCl, 2.5 KCl, 2.4 CaCl2, 1.2 NaH2PO4, 1.2 MgCl2, 11.1 glucose, and 21.4 NaHCO3, balanced with 95% O2/ 5% CO2, pH 7.4) to recover ~25 min at 32°C and subsequently for ≧1 h at room temperature before recording.

For whole-cell recording, slices were transferred to the recording chamber at room temperature and perfused continuously with aCSF bubbled with 95% O2/ 5% CO2 to ensure adequate oxygenation of slices. tdTomato+ neurons and tdTomato− neurons were identified by using epifluorescence and IR-DIC imaging on an upright microscope (Eclipse FN-1, Nikon) equipped with a moveable stage (MP-285, Sutter Instrument). Patch pipettes with resistances of 3–5 MΩ were filled with intracellular solution (adjusted to pH 7.3) containing (in mM: 128 K gluconate, 10 KCl, 10 HEPES, 0.1 EGTA, 2 MgCl2, 0.3 Na-GTP and 3 Mg-ATP). Recordings were made using a MultiClamp 700B amplifier (Axon Instrument), sampled using Digidata 1440A and analyzed offline with pClamp 10.3 software (Axon Instrument). Series resistance was monitored during the recording, and the values were generally <10 MΩ and were not compensated. The liquid junction potential was +12.5 mV, and was corrected after the experiment. Data were excluded if the series resistance increased more than 20% during the experiment or without overshoot for action potential. Currents were amplified, filtered at 1 kHz, and digitized at 20 kHz.

Current clamp was engaged to test neural firing frequency at the baseline and after puff delivery (Picospritzer III, Parker Hannifin) of VDR agonist 1,25-dihydroxyvitamin D3 (1,25D3) (5s at a concentration of 5 μM). The values for resting membrane potential and firing frequency were averaged within 2-min bin at the baseline or after 1,25D3 puff. In some experiments, the aCSF solution also contained 1 μm tetrodotoxin (TTX) and a cocktail of fast synaptic inhibitors, namely bicuculline (50 μM; a GABA receptor antagonist), D-AP5 (30 μM; an NMDA receptor antagonist) and CNQX (30 μM; an AMPA receptor antagonist) to block the majority of presynaptic inputs.

2.7. Glucose tolerance test:

Intraperitoneal glucose tolerance test was performed as previously published (Sisley et al., 2016). Briefly, mice were fasted for 4 hours, injected i.p. with 1.5 g/kg dextrose (D20W). A tail laceration was made and blood collected in duplicate at 0, 15, 30, 45, 60 and 120 min after dextrose administration in freely moving, conscious mice.

2.8. Statistics:

Statistical analyses were performed using GraphPad Prism. For immunohistochemistry experiments, real-time RT-PCR, and in vivo data, comparisons were made using unpaired t-tests or two-way ANOVA, as appropriate. The data for electrophysiology are presented individually for each recorded neuron. Comparisons between before and after vitamin D treatment were made by paired t-test. P < 0.05 was considered to be statistically significant.

3. Results

3.1. Specificity testing of VDR antibodies in mouse brains.

To verify the specificity of commonly used VDR antibodies in the brain, we performed immunohistochemistry on brains from wild type and VDR-null animals (Fig. 1). N-20, an antibody previously shown to have nuclear localization within the brain, also showed bright fluorescence in both wild type (Fig. 1b) and VDR-null (Fig. 1f) animals within the hypothalamus. Contrary to other reports showing no expression of VDR in the brain when using the D-6 antibody, we found similar expression of the VDR in both wild type (Fig. 1c) and VDR-null (Fig. 1g) mice in the hypothalamus. Although both antibodies were not specific for the VDR, we observed very little colocalization between their immunoreactivities. Interestingly, our results do not show non-specific staining throughout the hypothalamus, but rather discrete areas of staining in the arcuate and paraventricular hypothalamus, with some staining in the ventromedial and lateral hypothalamic nuclei, which was consistent between the two different antibodies. To confirm that the lack of antibody specificity was not due to aberrant VDR expression, we performed gene expression analysis of the VDR within whole hypothalamic samples and confirmed a lack of VDR expression (Fig. 1i). These results indicate that commercially available antibodies are not reliable for brain immunohistochemistry for VDR localization.

3.2. Creation and validation of a new VDRCre;Ai14 mouse.

In order to determine VDR expression in the brain, we created a new knockin mouse with Cre expression under the control of endogenous VDR expression (VDRCre). This was accomplished using a CRISPR-mediated approach for generating a V5-P2A-cre allele at the c-terminus of the VDR gene (Fig. 2a). Localization of the Cre recombinase to the VDR gene was verified through Sanger sequencing. We mated female VDRCre mice to a reporter mouse with Cre-dependent tdTomato expression, Ai14 (Jackson Laboratory; VDRCre;Ai14). VDRCre;Ai14 mice had similar body weight and glucose tolerance to their littermate controls (Fig. 2b, c). Cre knockin did not alter VDR expression in three tested peripheral tissues (Fig. 2d). tdTomato expression was highly expressed in peripheral tissues with high endogenous VDR expression (kidney and duodenum) and absent in liver, where there is low VDR expression (Fig. 2e). We then collected tdTomato+ and tdTomato− neurons from the hippocampus, and used single-cell real-time RT-PCR to show that all tdTomato+ neurons expressed VDR mRNAs but the majority of tdTomato− neurons did not (Fig. 2f).

Fig. 2.

Fig. 2.

Open in a new tab

Development and phenotype of VDRCre mice. (a) Schematic construction of the VDRCre transgenic mouse. Cre recombinase was targeted to the C-terminal of the VDR gene with a GGGGS linker, V5 tag and P2A sequence. Primer sequences A-E refer to sequences listed in Table 2. (b) Body weight comparison of VDRCre;Ai14 vs. control mice (n = 5–8/gp). (c) Intraperitoneal glucose tolerance test (1.5 g/kg dextrose) in same mice. (d) vdr expression in duodenum, kidney, and liver in VDRCre;Ai14 mice is similar to wild type controls (n=3–4 mice/tissue/group; samples normalized to tissue-specific housekeeping genes and then to average control duodenum expression). (e) tdTomato expression is significantly higher in duodenum and kidney of VDRCre;Ai14 mice, with no expression in liver (n=3–4 mice/tissue/group; samples normalized as in figure 2d). (f) vdr expression in hippocampal tdTomato+ neurons is significantly higher than in tdTomato- mice (n=8 neurons from one mouse/group; normalized to L32). (g) Absolute counts of tdTomato+ cells of VDRCre; Ai14 mice in areas of the whole brain (numbers are averages of 4–8 sections/mouse in 3 different mice per sex). * P < 0.05

3.3. Distribution of VDR expression in VDRCre;Ai14 mouse brains.

We then systematically characterized the distribution of VDRCre-mediated tdTomato fluorescence in fixed brain sections from both male and female mice, and found significant tdTomato signals in the cortex, caudate putamen (CPu), amygdala and reticular thalamic nucleus (Rt, Fig. 2g). Less intense tdTomato fluorescence was observed in the hypothalamus, hippocampus, dorsal Raphe nucleus (DRN), paraventricular thalamic nuclei (PVT), and bed nucleus of the stria terminalis (BNST, Fig. 2g). No differences in tdTomato signals were detected between male and female brains (Fig. 2g). We then used dual RNAscope to confirm that endogenous VDR mRNAs highly colocalized with tdTomato mRNAs in the cortex (Fig. 3a–d), CPu (Fig. 3e–h), BNST (Fig. 3i–l), Rt (Fig. 3m–p), amygdala (Fig. 3q–t), hippocampus (Fig. 4a–d), DRN (Fig. 4e–h), paraventricular hypothalamus (PVH, Fig. 4i–l), dorsomedial hypothalamus (DMH, Fig. 4m–p), and ventromedial hypothalamus (VMH, Fig. 4q–t). Notably, a portion of cortical cells expressed considerable levels of tdTomato mRNAs but no VDR mRNAs (Fig. 3a–c), suggesting that these cells, while did not express VDR at the time of perfusion, used to express VDR and therefore induced Cre activity to result in permanent expression of tdTomato.

Fig. 3.

Fig. 3.

Open in a new tab

Expression of tdTomato mRNAs and colocalization with VDR mRNAs in VDRCre male mice (part 1). Pictures of different brain areas are shown for tdTomato mRNAs (TD; magenta) and VDR mRNAs (VDR; green). Merged images show co-localized cells in white. Boxed area in merged image is enlarged in the adjacent image. BNST, bed nucleus of the stria terminalis; CPu, caudate putamen; Rt, reticular thalamic nucleus; LV, lateral ventricle. Scale bar = 100 μm for all except enlarged images (d, h, l, p, t) where scale bar = 25 μm.

Fig. 4.

Fig. 4.

Open in a new tab

Expression of tdTomato mRNAs and colocalization with VDR mRNAs in VDRCre male mice (part 2). Pictures of different brain areas are shown for tdTomato mRNAs (TD; magenta) and VDR mRNAs (VDR; green). Merged images show co-localized cells in white. Boxed area in merged image is enlarged in the adjacent image. 3V, third ventricle; Aq, aqueduct; ARH, arcuate hypothalamus; DMH, dorsomedial hypothalamus, DRN, dorsal Raphe nucleus; PVH, paraventricular hypothalamus, VMH, ventromedial hypothalamus. Scale bar = 100 μm for all except enlarged images (d, h, l, p, t) where scale bar = 25 μm.

3.4. Colocalization of tdTomato and hypothalamic cell-specific markers.

Given our previous data showing an importance for vitamin D action in the hypothalamus for glucose and weight regulation (Sisley et al., 2016), we also used dual-labeled immunohistochemistry in VDRCre;Ai14 mice to examine the colocalization of other cell markers with the VDR within the hypothalamus. Within the PVH, 17–18% of tdTomato+ neurons co-stained for oxytocin, whereas only 2–3% stained for vasopressin, and less than 1% for estrogen receptor-α (ERα; representative images in Fig. 5; absolute percentages in Table 3). Within the ARH, 5–6% of tdTomato+ cells colocalized with β-endorphin and 14–21% colocalized with ERα (representative images in Fig. 5; absolute percentages in Table 3). Although there was no difference between males and females in all of the above cell markers, in the VMH, ERα co-expressed with 1% tdTomato+ neurons in males but 8% tdTomato+ neurons in females, which was statistically significant (Table 3; p < 0.05).

Fig. 5.

Fig. 5.

Open in a new tab

Co-expression of key cell markers with VDR expression in the hypothalamus of male mice. Expression of tdTomato (Tom; magenta) and cell markers (green) for vasopressin (AVP; b), oxytocin (OXY;e), ERα (h, k), β-endorphin (n). Arrows denote cells with colocalization of tdTomato and GFP fluorescence. 3V, third ventricle; ARH, arcuate hypothalamus; PVH, paraventricular hypothalamus. Scale bar = 50 μm.

Table 3.

Percentage of tdTomato+ cells colocalized with specified cell marker.

Cell Marker – Hypothalamic Location % Tomato+ Colocalized Cells – Males ± SEM % Tomato+ Colocalized Cells – Females ± SEM
Vasopressin - PVH 3.17 ±0.95 1.95 ±0.08
Oxytocin - PVH 17.03 ±1.05 18.07 ± 1.92
β-endorphin – ARH 6.44 ± 1.92 5.65 ± 2.08
ERα - ARH 14.18 ± 2.28 21.53 ± 5.38
ERα - VMH 1.51 ±0.24 8.35 ± 1.52 *
Open in a new tab
*

P < 0.05 for males vs. females

3.5. Functional validation of tdTomato+ neurons using electrophysiology.

Using whole-cell current clamp electrophysiology, we examined the effects of the VDR agonist, 1,25-dihydroxyvitamin D3 (1,25D3) on the firing activities of tdTomato+ neurons in the PVH. We found that vitamin D (1,25D3, 5μM, puff for 5 seconds) significantly depolarized all tested tdTomato+ neurons (Fig. 6a, b, f) and increased their firing frequency (Fig. 6a, c, g) in both males and females. Importantly, we observed no effect of vitamin D on firing activity in tdTomato− neurons on resting membrane potential (Fig. 6a, b, f) or firing activity (Fig. 6a, c, g), supporting the specificity of the tdTomato fluorescence for the presence of the VDR. In addition, the treatment of vehicle alone failed to change the resting membrane potential or firing frequency of tdTomato+ neurons in either males or females (Fig. 6d, e, h and i). Further, we showed that vitamin D depolarized tdTomato+ neurons in the presence of TTX and a cocktail of glutamate and GABA receptor inhibitors in both sexes (Fig. 6j–l), indicating that vitamin D acts directly on these neurons to activate them.

Fig. 6.

Fig. 6.

Open in a new tab

Effects of VDR agonist on neural activities of tdTomato+ and tdTomato− cells in the PVH. a. Representative current clamp traces in response to vitamin D (1,25D3, 5μM, puff) in tdTomato+ and tdTomato− cells and to vehicle in tdTomato+ cells. b, c. Summary of resting membrane potential (b) and firing frequency (c) before and after vitamin D puff in female mice. d, e. Summary of resting membrane potential (d) and firing frequency (e) in tdTomato+ cells before and after vehicle puff in female mice. f, g. Summary of resting membrane potential (f) and firing frequency (g) before and after vitamin D puff in male mice. h, i. Summary of resting membrane potential (h) and firing frequency (i) in tdTomato+ cells before and after vehicle puff in male mice. j. Representative current clamp trace in response to vitamin D (5μM, puff) in tdTomato+ cells in the presence of 1 μM TTX, 30 μM CNQX, 30 μM D-AP5, and 50 μM bicuculline. k, l. Summary data of resting membrane potential before and after vitamin D puff in the presence of 1 μM TTX, 30 μM CNQX, 30 μM D-AP5, and 50 μM bicuculline. Data are presented for each cell collected from 2 male and 2 female mice. ***, P < 0.001 in paired t-tests.

4. Discussion

Multiple lines of evidence point to an important role for vitamin D in the brain. Vitamin D deficiency in utero causes changes in brain development that persist into adulthood in rodents (Féron et al., 2005). Our own data show an importance of vitamin D and VDR within the hypothalamus on glucose and body weight regulation (Sisley et al., 2016). Transcript expression data shows cerebral expression of important vitamin D synthesizing and metabolizing proteins in neurons, microglia, and astrocytes (Smolders et al., 2013). Along with other data (Xiaoying Cui et al., 2017), there is now a significant accumulation of data showing that vitamin D likely has important actions in the brain. Thus, having a reliable technique to localize VDR within the brain is important. We report here for the first time a mouse with Cre expression under endogenous VDR expression, which was histologically validated with VDR gene expression and functionally validated with electrophysiological experiments. This is also the first report colocalizing many hypothalamic markers in the VDR-positive neuronal population within the hypothalamus.

Although the staining patterns of the VDR antibodies in the brain clearly showed a lack of specificity due to the widespread staining in the VDR-null animals, there are interesting differences in their staining patterns. While the N-20 antibody had nuclear staining, the D-6 antibody seemed to have non-nuclear staining. VDR molecules are assumed to be mostly in the nucleus secondary to data demonstrating that calcitriol concentrates in the nuclei of brain neurons (Stumpf & O’Brien, 1987). However, there are also membrane-bound VDR receptors encoded by the same VDR gene (Mizwicki & Norman, 2009). The D-6 antibody has previously been published as the most specific VDR antibodies (Y. Wang et al., 2010), but interestingly, Wang et al. showed no staining within the brain. However, multiple other papers have supporting evidence for the VDR within the brain (discussed more below). While Wang et al. used paraffin embedded tissue and steps to retrieve antigen which included citric acid buffer and microwaving the slides, in our study, we did not paraffin embed the tissues and did not have any heating steps. It is possible that these methodological differences account for the difference in brain staining. Another group showed no detection of VDR by Western blotting utilizing the method by Wang et al, but a clear singular band utilizing another method (X Cui et al., 2013). Additionally, it appears that only one area of the brain was analyzed, although it is unclear which area this was (X Cui et al., 2013).

As noted previously, in 2013, another group used immunohistochemistry with the N-20 antibody and RT-PCR data to support the presence of the VDR in dopaminergic neurons of the midbrain (X Cui et al., 2013). However, as noted in our data, the N-20 antibody is not specific within the brain.

It seems unlikely that our lack of antibody specificity in the brain stems from a lack of VDR deletion in the null animal based on both the phenotype of the animals (poor growth, hair loss, and need for rescue diet) as well as real-time qRT-PCR measurements showing no VDR gene expression in the hypothalamus. Thus, it is more likely that the antibody staining present in our experiments is from the antibodies binding to other similar proteins. Another receptor which has the ability to bind 1,25D3 is the PDIA3/MARRS protein. Thus, it is an intriguing possibility that within the brain, the PDIA3/MARRS protein may confer a lack of specificity for one or more of the VDR antibodies.

Our data clearly showed the need for a new technique to localize the VDR within the brain. Through the creation of a VDRCre mouse, we showed expression of the VDR through fluorescence under the control of the endogenous VDR promoter. This data is consistent with previous work using autoradiography and gene expression analysis to support the presence of vitamin D receptors in the brain. Electrophoretic Mobility Shift Assay which used labeled probes for VDR binding sites, showed binding sites in neocortex, hippocampus, hypothalamus, striatum, midbrain, cerebellum, and medulla-pons (Taniura et al., 2006). The same group also performed in situ hybridization and found “detection throughout the mouse brain but …intense labeling…in the hippocampus and cerebellar cortex” (Taniura et al., 2006). Humans have a very similar pattern of VDR and 1,α-hydroxylase expression in the brain with highest staining in the prefrontal cortex, cingulate gyrus, hippocampus, caudate/putamen, substantia nigra, hypothalamus and cerebellum (Eyles et al., 2005). We show here similar labeling within the cerebral cortex, amygdala, midbrain, and hypothalamus although we did not characterize signals within the cerebellum.

Within the hypothalamus, autoradiographs of brains from intravenous injected 3H-1,25D3 show radioactivity accumulation in parvocellular but not magnocellular PVH. Within human hypothalamus, intense immunoreactivity has been shown in supraoptic and paraventricular nuclei (Eyles et al., 2005). Although this work was done with immunohistochemistry (and it is unclear which antibody was used), it is consistent with our data. Magnocellular cells within the PVH are generally oxytocin or vasopressin-producing cells. We detected very little colocalization of VDR+ cells with vasopressin and ~ 17% contained oxytocin. A previous study utilizing the 9A7 antibody reported that 30% of the magnocellular nuclei of the PVH were VDR positive and of these, ~50% were immunoreactive for oxytocin (Prüfer & Jirikowski, 1997). This is considerably higher than our results and likely stems from differences in antibody specificity between the studies. Thus, it is still unclear what types of cells contain VDR within the PVH.

Intriguingly, our previous data showed intra-third ventricular vitamin D (0.1 μg 1,25D3) administration caused neuronal activation within the PVH (as measured by cfos staining) and that knockdown of the VDR specifically within the PVH resulted in glucose intolerance (Sisley et al., 2016). Here, we report higher expression of VDR within the VMH and ARH compared to the PVH. Determining the effects of the VDR in these areas will be important next steps.

Our data also functionally validate identified VDR+ neurons. In addition to genomic actions, vitamin D is well known to have rapid, non-genomic actions in peripheral and neuronal cells (Delgado et al., 2017; Tamayo et al., 2018). We have previously shown that 1,25D3 activates just under 50% of randomly recorded neurons within the ARH (Sisley et al., 2016) and activates ~ 73% of randomly recorded PVH neurons (da Silva Teixeira et al., 2020). However, what was not clear previously was whether the neurons not responding to 1,25D3 contained the VDR. Here, we were able to specifically test the effects of 1,25D3 on VDR+ vs. VDR− neurons and found that all tested PVH VDR+ neurons responded to 1,25D3 while none of VDR− neurons responded. Importantly, 1,25D3-induced depolarization persisted in the presence of TTX and cocktail of synaptic inhibitors, highlighting a direct and rapid VDR action on neuron activity. This rapid induction of neuronal activity is faster than other reports of vitamin D action (Biswas & Zanello, 2009; Gooch et al., 2019), although these are in different cell types and utilize different doses and experimental paradigms. However, these rapid effects are in line with effects of agonists of other classic nuclear receptors such as ERα (C. Wang et al., 2018; Yu et al., 2020). Thus, these results give additional support to our mouse model as being a reliable indicator of VDR expression in the brain.

5. Conclusion.

Given the vast amount of data linking vitamin D to neurological diseases, determining the expression patterns and characteristics of VDR+ neurons is vitally important. While previous studies have used antibodies to determine localization, we show here that these antibodies are non-specific in a VDR-null mouse. Thus, we generated and validated a new mouse line which allows for specific determination of the VDR within the brain. We also show evidence supporting the importance of the VDR within the brain to confer rapid actions of 1,25D3, the endogenous ligand for the VDR. Other researchers may be able to use this VDRCre mouse with Cre-loxP gene deletion experiments, optogenetics/chemogenetics, neuronal tracing, colocalization, fluorescence activated cell sorting, or TRAP-seq among others to site specifically determine actions and potential mechanisms for VDR actions in the brain. Thus, we propose that our VDRCre mouse is an important tool for a variety of experimental designs to study the role of the VDR within the brain.

Acknowledgements:

We thank Denise Lanza and Jason Heaney from the BCM Mouse ES Cell Core for the targeting design, and Lauryl Nutter at The Centre for Phenogenomics (Toronto) for the donor DNA synthesis protocol. We also thank Danielle Harper for her technical expertise with some of the immunohistochemistry experiments. We thank Qingchun Tong for critical reading of the manuscript.

Funding: This work was supported by the American Diabetes Association [1-17-JDF-037 to SS], the American Heart Association [16BGIA27610017 to SS], the U.S. Department of Agriculture, Agriculture Research Service [cooperative agreement no. 58-6250-6-001; 3092-5-001-059]. Resources accessed through the BCM Mouse ES Cell and Genetically Engineered Mouse Cores were also supported by the National Institutes of Health [P30 CA125123]. HL is supported by China Scholarship Council (File No. 201906370218).

Footnotes

Declaration of Interests: SS receives support from Rhythm Pharmaceuticals for scientific advisory boards and for Speakers Bureau engagements.

Data will be made available upon request.

References

  1. Bassett AR, Tibbit C, Ponting CP, & Liu J-L (2013). Highly Efficient Targeted Mutagenesis of Drosophila with the CRISPR/Cas9 System. Cell Reports, 4(1), 220–228. 10.1016/j.celrep.2013.06.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Biswas P, & Zanello LP (2009). 1alpha,25(OH)(2) vitamin D(3) induction of ATP secretion in osteoblasts. Journal of Bone and Mineral Research : The Official Journal of the American Society for Bone and Mineral Research, 24(8), 1450–1460. 10.1359/jbmr.090306 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cao X, Xu P, Oyola MG, Xia Y, Yan X, Saito K, Zou F, Wang C, Yang Y, Jr AH, Yan C, Ding H, Zhu L, Yu L, Yang B, Feng Y, Clegg DJ, Khan S, Dimarchi R, … Xu Y. (2014). Estrogens stimulate serotonin neurons to inhibit binge-like eating in mice. 10.1172/JCI74726 [DOI] [PMC free article] [PubMed]
  4. Choe HK, Reed MD, Benavidez N, Montgomery D, Soares N, Yim YS, & Choi GB (2015). Oxytocin Mediates Entrainment of Sensory Stimuli to Social Cues of Opposing Valence. Neuron, 87(1), 152–163. 10.1016/j.neuron.2015.06.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cui X, Pelekanos M, Liu P-Y, Burne THJ, McGrath JJ, & Eyles DW (2013). The vitamin D receptor in dopamine neurons; its presence in human substantia nigra and its ontogenesis in rat midbrain. Neuroscience, 236, 77–87. 10.1016/j.neuroscience.2013.01.035 [DOI] [PubMed] [Google Scholar]
  6. Cui Xiaoying, Gooch H, Petty A, McGrath JJ, & Eyles D. (2017). Vitamin D and the brain: Genomic and non-genomic actions. Molecular and Cellular Endocrinology, 453, 131–143. 10.1016/j.mce.2017.05.035 [DOI] [PubMed] [Google Scholar]
  7. da Silva Teixeira S, Harrison K, Uzodike M, Rajapakshe K, Coarfa C, He Y, Xu Y, & Sisley S. (2020). Vitamin D actions in neurons require the PI3K pathway for both enhancing insulin signaling and rapid depolarizing effects. Journal of Steroid Biochemistry and Molecular Biology, 200. 10.1016/j.jsbmb.2020.105690 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Delgado C, Manzanares E, Bas M, Martín-Nunes L, Val-Blasco A, Jesús Larriba M, Fernández-Velasco M, & Delgado C. (2017). Calcitriol (1,25-dihydroxyvitamin D3) increases L-type calcium current via protein kinase A signaling and modulates calcium cycling and contractility in isolated mouse ventricular myocytes. Heart Rhythm, 14(3), 432–439. 10.1016/j.hrthm.2016.12.013 [DOI] [PubMed] [Google Scholar]
  9. Eyles DW, Smith S, Kinobe R, Hewison M, & McGrath JJ (2005). Distribution of the vitamin D receptor and 1 alpha-hydroxylase in human brain. Journal of Chemical Neuroanatomy, 29(1), 21–30. 10.1016/j.jchemneu.2004.08.006 [DOI] [PubMed] [Google Scholar]
  10. Fernandes de Abreu DA, Eyles D, & Féron F. (2009). Vitamin D, a neuro-immunomodulator: implications for neurodegenerative and autoimmune diseases. Psychoneuroendocrinology, 34 Suppl 1, S265–77. 10.1016/j.psyneuen.2009.05.023 [DOI] [PubMed] [Google Scholar]
  11. Féron F, Burne THJ, Brown J, Smith E, McGrath JJ, Mackay-Sim A, & Eyles DW (2005). Developmental Vitamin D3 deficiency alters the adult rat brain. Brain Research Bulletin, 65(2), 141–148. 10.1016/j.brainresbull.2004.12.007 [DOI] [PubMed] [Google Scholar]
  12. Gooch H, Cui X, Anggono V, Trzaskowski M, Tan MC, Eyles DW, Burne THJ, Jang SE, Mattheisen M, Hougaard DM, Pedersen BN, Cohen A, Mortensen PB, Sah P, & McGrath JJ (2019). 1,25-Dihydroxyvitamin D modulates L-type voltage-gated calcium channels in a subset of neurons in the developing mouse prefrontal cortex. Translational Psychiatry, 9(1). 10.1038/s41398-019-0626-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Helwig M, Khorooshi RMH, Tups A, Barrett P, Archer ZA, Exner C, Rozman J, Braulke LJ, Mercer JG, & Klingenspor M (2006). PC1/3 and PC2 gene expression and post-translational endoproteolytic pro-opiomelanocortin processing is regulated by photoperiod in the seasonal Siberian hamster (Phodopus sungorus). Journal of Neuroendocrinology, 18(6), 413–425. 10.1111/j.1365-2826.2006.01431.x [DOI] [PubMed] [Google Scholar]
  14. Holmøy T, & Moen SM (2010). Assessing vitamin D in the central nervous system. Acta Neurologica Scandinavica. Supplementum, 190, 88–92. 10.1111/j.1600-0404.2010.01383.x [DOI] [PubMed] [Google Scholar]
  15. Hrabovszky E, Kalló I, Steinhauser A, Merchenthaler I, Coen CW, Petersen SL, & Liposits Z. (2004). Estrogen receptor-β in oxytocin and vasopressin neurons of the rat and human hypothalamus: Immunocytochemical and in situ hybridization studies. Journal of Comparative Neurology, 473(3), 315–333. 10.1002/cne.20127 [DOI] [PubMed] [Google Scholar]
  16. Kaneko I, Sabir MS, Dussik CM, Whitfield GK, Karrys A, Hsieh JC, Haussler MR, Meyer MB, Pike JW, & Jurutka PW (2015). 1,25-DihydroxyVitamin D regulates expression of the tryptophan hydroxylase 2 and leptin genes: Implication for behavioral influences of Vitamin D. FASEB Journal, 29(9), 4023–4035. 10.1096/fj.14-269811 [DOI] [PubMed] [Google Scholar]
  17. Landel V, Stephan D, Cui X, Eyles D, & Feron F. (2017). Differential expression of vitamin D-associated enzymes and receptors in brain cell subtypes. The Journal of Steroid Biochemistry and Molecular Biology. 10.1016/j.jsbmb.2017.09.008 [DOI] [PubMed] [Google Scholar]
  18. Lim BN, Choong YS, Ismail A, Glokler J, Konthur Z, & Lim TS (2012). Directed evolution of nucleotide-based libraries using lambda exonuclease. BioTechniques, 53(6), 357–364. 10.2144/000113964 [DOI] [PubMed] [Google Scholar]
  19. Mizwicki MT, & Norman AW (2009). The vitamin D sterol-vitamin D receptor ensemble model offers unique insights into both genomic and rapid-response signaling. Science Signaling, 2(75), re4. 10.1126/scisignal.275re4 [DOI] [PubMed] [Google Scholar]
  20. Morita M, Kita Y, Morikawa N, Iwami M, & Notsu Y. (2001). Expression of arginine vasopressin and vasopressin V1a receptor mRNA in diabetic (db/db) mice. Experimental and Clinical Endocrinology and Diabetes, 109(5), 261–266. 10.1055/s-2001-16345 [DOI] [PubMed] [Google Scholar]
  21. Patrick RP, & Ames BN (2014). Vitamin D hormone regulates serotonin synthesis. Part 1: Relevance for autism. FASEB Journal, 28(6), 2398–2413. 10.1096/fj.13-246546 [DOI] [PubMed] [Google Scholar]
  22. Prüfer K, & Jirikowski GF (1997). 1.25-Dihydroxyvitamin D3 receptor is partly colocalized with oxytocin immunoreactivity in neurons of the male rat hypothalamus. Cellular and Molecular Biology (Noisy-Le-Grand, France), 43(4), 543–548. http://www.ncbi.nlm.nih.gov/pubmed/9220147 [PubMed] [Google Scholar]
  23. Prüfer K, Veenstra TD, Jirikowski GF, & Kumar R. (1999). Distribution of 1,25-dihydroxyvitamin D3 receptor immunoreactivity in the rat brain and spinal cord. Journal of Chemical Neuroanatomy, 16(2), 135–145. http://www.ncbi.nlm.nih.gov/pubmed/10223312 [DOI] [PubMed] [Google Scholar]
  24. Ramot A, Jiang Z, Tian J.Bin, Nahum T, Kuperman Y, Justice N, & Chen A. (2017). Hypothalamic CRFR1 is essential for HPA axis regulation following chronic stress. Nature Neuroscience, 20(3), 385–388. 10.1038/nn.4491 [DOI] [PubMed] [Google Scholar]
  25. Saito K, He Y, Yan X, Yang Y, Wang C, Xu P, Hinton AO, Shu G, Yu L, Tong Q, & Xu Y. (2016). Visualizing estrogen receptor-α-expressing neurons using a new Erα-ZsGreen reporter mouse line. Metabolism: Clinical and Experimental, 65(4), 522–532. 10.1016/j.metabol.2015.12.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Schneider CA, Rasband WS, & Eliceiri KW (2012). NIH Image to ImageJ: 25 years of image analysis. Nature Methods, 9(7), 671–675. http://www.ncbi.nlm.nih.gov/pubmed/22930834 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Sisley SR, Arble DM, Chambers AP, Gutierrez-Aguilar R, He Y, Xu Y, Gardner D, Moore DD, Seeley RJ, & Sandoval DA (2016). Hypothalamic Vitamin D Improves Glucose Homeostasis and Reduces Weight. Diabetes, 65(9), 2732–2741. 10.2337/db16-0309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Smolders J, Schuurman KG, van Strien ME, Melief J, Hendrickx D, Hol EM, van Eden C, Luchetti S, & Huitinga I. (2013). Expression of vitamin D receptor and metabolizing enzymes in multiple sclerosis-affected brain tissue. Journal of Neuropathology and Experimental Neurology, 72(2), 91–105. 10.1097/NEN.0b013e31827f4fcc [DOI] [PubMed] [Google Scholar]
  29. Stumpf WE, & O’Brien LP (1987). 1,25 (OH)2 vitamin D3 sites of action in the brain. An autoradiographic study. Histochemistry, 87(5), 393–406. http://www.ncbi.nlm.nih.gov/pubmed/2828283 [DOI] [PubMed] [Google Scholar]
  30. Tamayo M, Martin-Nunes L, Val-Blasco A, Piedras MJ, Larriba MJ, Gómez-Hurtado N, Fernández-Velasco M, & Delgado C. (2018). Calcitriol, the bioactive metabolite of vitamin D, increases ventricular K+ currents in isolated mouse cardiomyocytes. Frontiers in Physiology, 9(AUG). 10.3389/fphys.2018.01186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Taniura H, Ito M, Sanada N, Kuramoto N, Ohno Y, Nakamichi N, & Yoneda Y. (2006). Chronic vitamin D3 treatment protects against neurotoxicity by glutamate in association with upregulation of vitamin D receptor mRNA expression in cultured rat cortical neurons. Journal of Neuroscience Research, 83(7), 1179–1189. 10.1002/jnr.20824 [DOI] [PubMed] [Google Scholar]
  32. Wang C, He Y, Xu P, Yang Y, Saito K, Xia Y, Yan X, Hinton A, Yan C, Ding H, Yu L, Shu G, Gupta R, Wu Q, Tong Q, Lagor WR, Flores ER, & Xu Y. (2018). TAp63 contributes to sexual dimorphism in POMC neuron functions and energy homeostasis. Nature Communications, 9(1), 1544. 10.1038/s41467-018-03796-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang Y, Becklund BR, & DeLuca HF (2010). Identification of a highly specific and versatile vitamin D receptor antibody. Archives of Biochemistry and Biophysics, 494(2), 166–177. 10.1016/j.abb.2009.11.029 [DOI] [PubMed] [Google Scholar]
  34. Wang Y, Zhu J, & DeLuca HF (2012). Where is the vitamin D receptor? Archives of Biochemistry and Biophysics, 523(1), 123–133. 10.1016/j.abb.2012.04.001 [DOI] [PubMed] [Google Scholar]
  35. Yang Y, van der Klaauw AA, Zhu L, Cacciottolo TM, He Y, Stadler LKJ, Wang C, Xu P, Saito K, Hinton A, Yan X, Keogh JM, Henning E, Banton MC, Hendricks AE, Bochukova EG, Mistry V, Lawler KL, Liao L, … Xu Y. (2019). Steroid receptor coactivator-1 modulates the function of Pomc neurons and energy homeostasis. Nature Communications, 10(1), 1718. 10.1038/s41467-019-08737-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yu K, He Y, Hyseni I, Pei Z, Yang Y, Xu P, Cai X, Liu H, Qu N, Liu H, He Y, Yu M, Liang C, Yang T, Wang J, Gourdy P, Arnal J-F, Lenfant F, Xu Y, & Wang C. (2020). 17β-estradiol promotes acute refeeding in hungry mice via membrane-initiated ERα signaling. Molecular Metabolism, 101053. 10.1016/j.molmet.2020.101053 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES