KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Mouse strains | ||
| C57BL/6 | Charles River | N/A |
| CD45.1+ C57BL/6 | Charles River | N/A |
| C57BL/6 | The Jackson Lab | N/A |
| CD4CRE | The Jackson Lab | Stock No. 022071 |
| TCRα−; P14 TCRVα2Vβ8 | The Jackson Lab | Stock No. 37394-JAX |
| Rag2−/− C57BL/6 | The Jackson Lab | Stock No: 008449 |
| LSL-Cas9-GFP | The Jackson Lab | Stock No: 026175 |
| Constitutive-Cas9-GFP | The Jackson Lab | Stock No: 026179 |
| Flow cytometry reagents | ||
| Live/Dead Aqua Dye | Thermofisher | Cat# L34957 |
| Live/Dead Zombie NIR Dye | BioLegend | Cat# 423106 |
| Anti-Mouse KLRG1(2F1) | BD Biosciences | Cat# 561619, RRID:AB_10898017 |
| Anti-Mouse CD127(A7R34) | BioLegend | Cat# 135016, RRID:AB_1937261 |
| Anti-Mouse CD8(53-6.7) | BioLegend | Cat# 100742, RRID:AB_2563056 |
| Anti-Mouse CD44(IM7) | BioLegend | Cat# 103059, RRID:AB_2571953 |
| Anti-Mouse CD45.1(A20) | BioLegend | Cat# 110724, RRID:AB_493733; Cat# 110716, RRID:AB_313505 |
| Anti-Mouse CD45.2(104) | BioLegend | Cat# 109828, RRID:AB_893350; Cat# 109823, RRID:AB_830788 |
| Anti-Mouse Ly108(330-AJ) | BioLegend | Cat# 134608, RRID:AB_2188093; Cat# 134605, RRID:AB_1659258 |
| Anti-Mouse Tim-3(RMT3-23) | BioLegend | Cat# 119721, RRID:AB_2616907 |
| Anti-Mouse CD39(24DMS1) | Thermofisher | Cat# 46-0391-80, RRID:AB_10717513 |
| Anti-Mouse PD-1(RMP1-30) | BioLegend | Cat# 109109, RRID:AB_572016 |
| Anti-Mouse CD28 | BioLegend | Cat# 644808, RRID:AB_1595479 |
| Anti-Mouse CX3CR1 | Thermofisher | Cat# 50-4875-80, RRID:AB_2574226 |
| Anti-Mouse CXCR3 | BioLegend | Cat# 652420, RRID:AB_2564285 |
| Anti-Mouse TCF-1(S33-966) | BD Biosciences | Cat# 564217, RRID:AB_2687845 |
| Anti-Mouse Gzmb (GB11) | Thermofisher | Cat# GRB17, RRID:AB_2536540 |
| Anti-Mouse T-bet(4B10) | BioLegend | Cat# 644808, RRID:AB_1595479 |
| Anti-Mouse Eomes(Dan11mag) | Thermofisher | Cat# 50-4875-80, RRID:AB_2574226 |
| Anti-Human(Mouse) Tox(REA473) | Miltenyl. Biotec. | Cat# 130-118-335, RRID:AB_2751485 |
| Anti-Mouse Bcl-2(A19-3) | BD Biosciences | Cat# 556537, RRID:AB_396457 |
| Anti-Mouse Bim(C34C5) | Cell Signaling Technology | Cat# 2933, RRID:AB_1030947 |
| Anti-Mouse Bcl-xL(H-5) | Santa Cruz Biotech. | Cat# sc-8392, RRID:AB_626739 |
| Anti-Mouse CD107a(1D4B) | BioLegend | Cat# 121606, RRID:AB_572007 |
| Anti-Mouse TNFα(MP6-XT22) | BioLegend | Cat# 506328, RRID:AB_2562902 |
| Anti-Mouse IFNγ(XMG1.2) | BD Biosciences | Cat# 560661, RRID:AB_1727534 |
| Anti-Mouse MIP-1α(39624) | R&D Systems | Cat# IC450P, RRID:AB_2244085 |
| BD GolgiStop | Thermofisher | Cat# 554724 |
| BD GolgiPlug | Thermofisher | Cat# 555029 |
| LCMV DbGP33 tetramer | NIH | Conjugated in house |
| Foxp3 Transcription Factor Staining Buffer Kit | Thermofisher | Cat# A25866A |
| Experimental Models | ||
| LCMV Clone13 (Cl13) | Rafi Ahmed | Grew up in house |
| LCMV Armstrong (Arm) | Rafi Ahmed | Grew up in house |
| Listeria Monocytogenes-DbGP33 | Hao Shen | Grew up in house |
| Influenza-PR8-DbGP33 | Richard J. Webby | Grew up at St. Jude Children’s Hospital |
| Influenza PA protein sense primer | (Laidlaw et al., 2013) | CGGTCCAAATTCCTGCTGAT |
| Influenza PA protein anti-sense primer | (Laidlaw et al., 2013) | CATTGGGTTCCTTCCATACA |
| Influenza PA protein probe | (Laidlaw et al., 2013) | 6FAMCCAAGTCATGAAGGAGAGGGAATACCGCTTAMRA |
| B16-DbGP33 | (Prévost-Blondel et al., 1998) | Grew up in house |
| In vitro culture and retroviral transduction reagents | ||
| Recombinant human IL-2 | NIH | N/A |
| Anti-Mouse CD3(145-2C11) | BioLegend | Cat# 100302, RRID:AB_312667 |
| Anti-Mouse CD28(37.51) | Thermofisher | Cat# 16-0281-82, RRID:AB_468921 |
| EasySep™ Mouse CD8+ T Cell Isolation Kit | STEMCELL Technologies | Cat# 19853 |
| RPMI-1640 medium | Corning/Mediatech | Cat# 10-040-CV |
| DMEM medium | Corning/Mediatech | Cat# 10-017-CV |
| HI Fetal Bovine Serum | Thermofisher | Cat# 26170-043 |
| HEPES | Thermofisher | Cat# 15630080 |
| Non-Essential Amino Acids | Thermofisher | Cat# 11140050 |
| Penicillin-Streptomycin | Thermofisher | Cat# 15140122 |
| β-mercaptoethanol | Sigma-Aldrich | Cat# M6250-500ML |
| Opti-MEM | Thermofisher | Cat# 31985088 |
| Polybrene | Sigma-Aldrich | Cat# TR-1003-G |
| Lipofectamine™ 3000 Transfection Reagent | Thermofisher | Cat# L3000001 |
| Molecular constructs | ||
| Runx1 overexpression vector | Nancy A. Speck; Addgene | N/A; Addgene Cat#80157 |
| Runx3 overexpression vector | In this paper | N/A |
| Fli1 overexpression vector | In this paper | N/A |
| Empty-VEX retroviral vector | (Kurachi et al. 2017) | N/A |
| Empty-mCherry retroviral vector | (Kurachi et al. 2017) | N/A |
| pSL21-VEX | In this paper | Addgene Cat#158230 |
| pSL21-mCherry | In this paper | Addgene Cat#164410 |
| LRG2.1 | Addgene | Cat#108098 |
| MSCV Retroviral Expression System | Takara Bio. | Cat#634401 |
| BbsI | NEB | Cat#R0539L |
| Esp3I(BsmBI) | Thermofisher | Cat#ER0451 |
| Phusion Flash High Fidelity PCR Master Mix with HF buffer | Thermofisher | Cat#F531L |
| Gibson Assembly Master Mix | NEB | Cat#E2611L |
| T4 DNA Polymerase | NEB | Cat#M0203L |
| DNA Polymerase I, Large (Klenow) Fragment | NEB | Cat#M0210L |
| T4 polynucleotide kinase | NEB | Cat#M0201L |
| Klenow Fragment | NEB | Cat#M0212L |
| PrimeSTAR HS DNA Polymerase | Takara Bio. | Cat#R040A |
| Quick T4 DNA Ligase | NEB | Cat#M2200 |
| Antibodies for biochemical experiments | ||
| Anti-Mouse Fli1 | Abcam | Cat# ab15289 |
| Guinea Pig anti-Rabbit IgG (Heavy & Light Chain) Antibody | Antibodies-online | Cat# ABIN101961 |
| Anti-Mouse GAPDH | Cell Signaling Technology | Cat# 14C10 |
| IRDye 800 CW Goat anti-Rabbit Antibody | Licor | #92632211 |
| RNA-Sequencing Processing Reagents | ||
| RNeasy Micro Kit | Qiagen | Cat# 74004 |
| SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (24 rxn) | Takara Bio | Cat# 634889 |
| Nextera XT DNA Library Preparation Kit | Illumina | Cat# FC-131-1024 |
| Agencourt AMPure XP | Beckman | Cat# A63880 |
| HSD5000 ScreenTape | Agilent | Cat# 5067-5592 |
| HSD1000 ScreenTape | Agilent | Cat# 5067-5584 |
| ATAC-Sequencing Processing Reagents | ||
| IGEPAL-CA-630 | Sigma-Aldrich | Cat# I8896 |
| Tn5 Transposes | Illumina | Cat# FC-121-1030 |
| MinElute PCR Purification Kit | Qiagen | Cat# 28004 |
| NEBNext High-Fidelity 2x PCR Master Mix | New England Labs | Cat# M0541 |
| CUT&RUN Processing Reagents | ||
| Digitonin | Millipore | Cat# 300410-1GM |
| BioMag Plus Concanavalin A (10mL) | Bangs laboratories | Cat# BP531 |
| Complete, EDTA-free Protease Inhibitor Cocktail | Sigma | Cat# 4693132001 |
| Glycogen | Thermo | Cat# R0561 |
| Proteinase K | Denville Scientific | Cat# CB3210-5 |
| RNase A | Thermo | Cat# EN0531 |
| Spermidine | Sigma | Cat# 85558-1G |
| NEB Next Ultra II DNA library prep kit | NEB | Cat# E7645L |
| Illumina Sequencing Reagents | ||
| NEBNext Library Quant Kit for Illumina | NEB | Cat# E7630L |
| NextSeq 500/550 High Output Kit (75 cycles) v2.5 kit | Illumina | Cat# 20024906 |
| NextSeq 500/550 High Output Kit (150 cycles) v2.5 kit | Illumina | Cat# 20024907 |
| Software and Algorithms | ||
| FlowJo v10.4.2 | TreeStar | https://www.flowjo.com/solutions/flowjo/downloads |
| Prism Version 8 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| IGV v2.4.16 | The Broad Institute | https://software.broadinstitute.org/software/igv/download |
| Deseq2 | (Love et al., 2014) | http://www.bioconductor.org/packages/release/bioc/html/DESeq2.html |
| Great (v3.0) | (McLean et al., 2010) | http://great.stanford.edu/public/html/ |
| GSEA (v3.0) | The Broad Institute | http://software.broadinstitute.org/gsea/index.jsp |
| ClusterProfiler | (Yu et al., 2012) | https://guangchuangyu.github.io/2016/01/go-analysis-using-clusterprofiler/ |
| Homer (v4.6) | (Heinz et al., 2010) | http://homer.ucsd.edu/homer/download.html |
| Bowtie2 v2.3.4.1 | (Langmead and Salzberg, 2012) | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Picard v1.96 | The Broad Institute | https://broadinstitute.github.io/picard/index.html |
| Samtools v1.1 | (Li et al., 2009) | http://samtools.sourceforge.net |
| Bedtools v2.28.0 | (Quinlan and Hall, 2010) | https://bedtools.readthedocs.io/en/latest/# |
| bedGraphToBigWig (UCSC) | UCSC Genome | http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/ |
| MACS v2.1 | (Zhang et al., 2008) | https://github.com/taoliu/MACS |
| HOMER v4 | (Heinz et al., 2010) | http://homer.ucsd.edu/homer/ |
| ChIPpeakAnno | (Zhu et al., 2010) | https://bioconductor.org/packages/release/bioc/html/ChIPpeakAnno.html |
| ComplexHeatmap | (Gu et al., 2016) | https://bioconductor.org/packages/release/bioc/html/ComplexHeatmap.html |
| Datasets | ||
| Blacklist | ENCODE | https://sites.google.com/site/anshulkundaje/projects/blacklists |
| TEFF gene signature | (Bengsch et al., 2018) | N/A |
| TEX precursor gene signature | (Chen et al., 2019b) | GSE131535 |
| sgCtrl vs sgFli1 RNA sequencing at D8 Cl13 p.i. |
In this paper | GSE149838 |
| sgCtrl vs sgFli1 ATAC sequencing at D9 Cl13 p.i. |
In this paper | GSE149836 |
| IgG vs Fli1-ab(ab15289) CUT&RUN Sequencing at D8 Cl13 p.i. |
In this paper | GSE149837 |