REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
PAX6 antibody	BioLegend	Cat# 901301
CRX antibody	Abnova	Cat# H00001406-M02
Rhodopsin	Sigma	Cat# O4886
Recoverin	Millipore	Cat# AB5585
L/M-opsin	Millipore	Cat# AB5405
ARL13B	ProteinTech	Cat# 17711-1-ap
DAPI	Invitrogen Antibodies	Cat# D-1306
Donkey anti-rabbit 594	Invitrogen Antibodies	Cat# A-21207
Donkey anti-rabbit 488	Invitrogen Antibodies	Cat# A-21206
Donkey anti-mouse 594	Invitrogen Antibodies	Cat# A-21203
Donkey anti-mouse 488	Invitrogen Antibodies	Cat# A-21202
Chemicals, peptides, and recombinant proteins
GlutaMAX	Life Technologies	Cat# 35050-061
MEM non-essential amino acid solution (100×) (NEAA)	Sigma	Cat# M7145
Fetal bovine serum (FBS)	Biological Industries	Cat# 04-002-1A
AlbuMAX II Lipid-Rich BSA	Gibco	Cat# 11021037
Primocin	InvivoGen	Cat# ant-pm-1
Penicillin-streptomycin (PS)	Gibco	Cat# 15140-122
Dimethyl sulfoxide (DMSO)	Sigma	Cat# D2650
TrypLE Select (1×), no phenol red	Life Technologies	Cat# 12563-011
Accutase	STEMCELL Technologies Inc	Cat# 07920
DNase I	Roche	Cat# 11284932001
Y-27632-2HCl	Selleck	Cat# S1049
KnockOut Serum Replacement - Multi-Species (KSR)	Gibco	Cat# A3181502
Chemically Defined Lipid Concentrate	Thermo	Cat# 11905031
Monothioglycerol	Sigma	Cat# M6145
Recombinant human BMP4	R&D Systems	Cat# 314-BP
N-2 Supplement (100×), liquid	Life Technologies	Cat# 17502-048
Retinoic acid (RA)	Sigma	Cat# R2625
Taurine	Sigma	Cat# T8691
Matrigel, Growth Factor Reduced (GFR) Basement Membrane Matrix, Phenol Red-Free, ∗LDEV-Free	Corning	Cat# 356231
EmbryoMax 0.1% Gelatin Solution	Millipore	Cat# ES-006-B
G418 disulfate salt	Sigma	Cat# G1279
Agarose, low gelling temperature	Sigma-Aldrich	Cat# A0701
Critical commercial assays
DMEM/Ham’s F12	Gibco	Cat# 10565-042
Ham’s F12	Gibco	Cat# 11765-054
DMEM basic	Gibco	Cat# C11995500bt
Dulbecco's phosphate buffered saline (DPBS)	Gibco	Cat# C141905005BT
TeSR-E8 Kit for hESC/hiPSC Maintenance	STEMCELL Technologies	Cat# 05990
ncEpic hPSC Medium	Nuwacell Biotechnologies Co., Ltd	Cat# RP01001
Iscove’s Modified Dulbecco Medium (IMDM)	Gibco	Cat# 12440053
Ham's F-12 Nutrient Mixture	Gibco	Cat# 11765-054
REGM BulletKit	Lonza	Cat# CC-3190
P3 Primary Cell 4D-Nucleofector X Kit L	Lonza	Cat# V4XP-3024
Cultured Cells DNA Kit	Simgen	Cat# 3001250
Phanta Super-Fidelity DNA Polymerase	Vazyme	Cat# P505-d3
2× power Taq PCR Master Mix	BioTeke	Cat# PR1702
P3 Primary Cell 4D-Nucleofector X Kit	Lonza	Cat# V4XP-3024
QIAquick Gel Extraction Kit (250)	QIAGEN	Cat# 28706
Endo-free Plasmid Mini Kit I (200)	Omega	Cat# D6948-02
pEASY-Blunt Simple Cloning Kit	TransGen Biotech	Cat# CB111-01
Oligonucleotides
Primer: pX330-sgRNA-F 5′- CACCGC ATGTAAACAACGTGTCACAA -3′	This paper	N/A
Primer: pX330-sgRNA-R 5′- AAACTTG TGACACGTTGTTTACATGC -3′	This paper	N/A
Primer F for correction verification CACAGACTAGAGAGTGGCAC	This paper	N/A
Primer R for correction verification CCTCTACCCTTGTCTTTCTC	This paper	N/A
Recombinant DNA
pX330 plasmid	Addgene	Cat# 42230
Episomal reprogramming plasmids	System Biosciences (SBI)	Cat# SC900A-1
Software and algorithms
Leica software	Leica	http://www.leica-microsystems.com/home/
CRISPR sgRNA design tool	CRISPOR	http://crispor.tefor.net/
Other
6-well plates	Cyagen	Cat# 40106
Non-stick 10-cm petri dish	Greiner	Cat# 663102
96-well V-bottomed conical wells	Sumitomo Bakelite	Cat# MS-9096VZ
1,000-μL Pipette tips	Axygen	Cat# T-1000-R-S
200-μL Universal Fit Pipet Tip	Axygen	Cat# T-200-Y-R-S
10-μL Microvolume Pipet Tips	Axygen	Cat# T-300-R-S
1.5 mL EP	Axygen	Cat# MCT-150-C
0.6 mL EP	Axygen	Cat# MCT-060-C
0.2 mL EP	Axygen	Cat# PCR-02-C
15-mL Centrifuge tube	BD Falcon	Cat# 352097
50-mL Centrifuge tube	BD Falcon	Cat# 352070
5-mL Pipetting tube	BD Falcon	Cat# 357543
10-mL Pipetting tube	BD Falcon	Cat# 357551
25-mL Pipetting tube	BD Falcon	Cat# 357525
1,000-μL Pipette tips	Axygen	Cat# T-1000-R-S
200-μL Pipette tips	Axygen	Cat# T-200-Y-R-S
10-μL pipette tips	Axygen	Cat# T-300-R-S
Cryopreservation tubes	Corning	Cat# 430488
Sterile square media bottle	Nalgene	Cat# c0006558
Millex-GP, 0.22-μm filter	Millpore	Cat# SLGP033RB
1-mL Injection needle	Kangkang	N/A
50-mL Injection needle	Kangkang	N/A
V-Lance knife	Alcon Surgical	Cat# 8065912001
Counting chambers	RONGYI	Cat# 1103
4°C freezers	Haier	Cat# HXC-936
−20°C freezers	Haier	Cat# BCD-256WDGK
−80°C freezers	Panasonic	Cat# MDF-U3386S
CO2 incubator	Thermo Scientific	Cat# 3111
Water bath	Yiheng	Cat# DK-8AB
Thermal cycler	Life Technologies	Cat# 4483636
Centrifuge	Eppendorf	Cat# 5702
Liquid nitrogen storage dewar	Thermo Scientific	Cat# CY50985
Class II, Type A2 Biosafety Cabinets	Thermo Scientific	Cat# 1300 Series A2
4D-Nucleofector Core Unit	Lonza	Cat# AAF-1002B
4D-Nucleofector X Unit	Lonza	Cat# AAF-1002X
Microscope	Life Technologies	Cat# EVOS XL