Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for qRT-PCR in this study
| Marker gene | Primer sequence (5’ → 3’) | Tm (°C) |
Reference | |
|---|---|---|---|---|
| COL | Forward | CTTCACCTACAGCACCCTTGTG | 59 | This study |
| Reverse | TGACTGTCTTGCCCCAAGTTC | 58 | This study | |
| OCN | Forward | GTGAGCTTAACCCTGCTTGTGA | 58 | This study |
| Reverse | TGCGTTTGTAGGCGGTCTTC | 60 | This study | |
| GAPDH | Forward | CCTGGCCAAGGTCATCCATG | 62 | Ref. [20] |
| Reverse | GCAGGAGACAACCTGGTCCT | 62 | Ref. [20] | |
