Table 1.

Primer and probe sequences used in this study.

Gene target	Sequence	Cycling conditions	Manufacturer	Reference
N2-F	TTACAAACATTGGCCGCAAA	Reverse transcription at 50 °C for 1 h, enzyme activation at 95 °C for 10 min, 40 cycles of denaturation at 94 °C for 30 s and annealing at 55 °C for 60 s. Deactivation of enzymes at 98 °C for 10 min and stabilization of the droplets at 4 °C for 30 min with a ramp rate of 2 °C/s	Inqaba Biotechnology (South Africa)	Giri et al. (2020)
N2-R	GCGCGACATTCCGAAGAA
N2-P	ACAATTTGC(ZEN)CCCCAGCGCTTCAG 5′ Modification: FAM 3′ Modification: Iowa Black® FQ		Integrated DNA Technologies	Barra et al. (2020)