REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse anti-His6 primary	Takara/Clontech	Cat# 631212, RRID: AB_2721905
HRP-conjugated goat anti-mouse IgG	Merck	Cat# A0168, RRID: AB_257867
Penta·His Antibody, BSA-free	Qiagen	Cat# 34660
Anti-Rho [1D4] monoclonal antibody	University of British Columbia	N/A
Anti-Flag produced in rabbit	Sigma-Aldrich	Cat# F7425 RRID: AB_10571678
Mouse anti-Tubulin	Santa Cruz Biotechnology Inc.	Cat# sc-23948 RRID: AB_10769716
Mouse anti-Tuj1	BioLegend	Cat# 801213 RRID:AB_10063408
Mouse anti-alpha-Tubulin	Sigma-Aldrich	Cat# T5168, RRID: AB_477579
Alexa Fluor 568-Phalloidin	Thermo-Fisher	Cat# A12380
Guinea pig anti-DCX	Merck	Cat# AB2253 RRID: AB_1586992
Goat anti-Neogenin	R&D	Cat# AF1079, RRID: AB_2151002
Rabbit anti-Neogenin	Santa Cruz	Cat# sc-15337 RRID:AB_2150998
Sheep anti-RGMB	R&D	Cat# AF3597, RRID: AB_2179484
Rat anti-Netrin1	R&D	Cat# MAB1109 RRID:AB_2154710
Goat anti-DCC	Santa Cruz	Cat# sc-6535 RRID: AB_2245770
Chicken anti-GFP	AVES	Cat# GFP-1020 RRID: AB_2307313
Rabbit anti-GFP	Invitrogen	Cat# A11122 RRID:AB_221569
Rabbit anti-GFP	Abcam	Cat# ab290 RRID:AB_303395
Mouse anti-FLAG	Stratagene	Cat #200471, RRID: AB_10596509
Goat anti-rabbit, Alexa Fluor 488	Life Technologies	CAT# A11034 RRID: AB_10374301
Donkey anti-Sheep, Alexa Fluor 488	Life Technologies	Cat# A-11015, RRID: AB_2534082
Goat anti-mouse, Alexa Fluor 555	Life Technologies	CAT# A21422 RRID: AB_2536164
Donkey anti-chicken, Alexa Fluor 488	Jackson Immunoresearch	Cat# 703-545-155 RRID:AB_2340375
Goat anti-Guinea Pig, Alexa Fluor 555	Thermo-Fisher	Cat# A-21435 RRID: AB_2535856
Donkey anti-goat HRP conjugate	Jackson ImmunoResearch	CAT# 705-035-003 RRID: AB_2340390
Goat anti-rabbit HRP conjugate	Jackson ImmunoResearch	CAT# 111-035-003 RRID: AB_2313567
Rabbit anti-sheep HRP conjugate	Abcepta	Cat# ASR1953
Goat anti-rat HRP conjugate	Santa Cruz	Cat# sc-2065 RRID: AB_631756
Streptavidin-HRP conjugate	Sigma-Aldrich	Cat# GERPN1231
Bacterial and Virus Strains
BL21-DE3	NEB	Cat# C2527I
DH5α	Invitrogen	Cat#: 18263012
Chemicals, Peptides, and Recombinant Proteins
Dulbecco’s Modified Eagle’s Medium, high glucose	Sigma-Aldrich	Cat# D5796
D-biotin	Sigma-Aldrich	Cat# B4639
Streptavidin	Sigma-Aldrich	Cat# S4762
Bovine serum albumin	Sigma-Aldrich	Cat# A4503-100G
Polyethylenimine, branched	Sigma-Aldrich	Cat# 408727
Fetal Bovine Serum	Life Technologies	Cat# 10270106
L-Glutamine	Thermo-Fisher	Cat# 25030081
MEM non-essential amino acids	Thermo-Fisher	Cat# 11140050
Neurobasal Medium	Thermo-Fisher	Cat# 21103049
Hank’s balanced salt solution (HBSS)	Life Technologies	Cat# 14170112
Trypsin-EDTA (0.25%), phenol red	Thermo-Fisher	Cat# 25200056
DMEM/F-12	Thermo-Fisher	Cat# 41966-029
DNase I	Roche	Cat# 1284932001
Penicillin-Streptomycin	Thermo-Fisher	Cat# 15140122
B27 serum-free supplement	Thermo-Fisher	Cat# 17504044
Poly-D-Lysine	Sigma-Aldrich	Cat# P0899-100MG
Poly-L-Lysine	Sigma-Aldrich	Cat# P2636
Laminin	Thermo-Fisher	Cat# 23017015
Recombinant Mouse RGM-A Protein	R&D Systems	Cat# 2458-RG-050
Recombinant Mouse Netrin-1 protein	R&D Systems	Cat# 1109-N1/CF
EGF recombinant human protein	Thermo-Fisher	Cat# PHG0311
cOmplete protease inhibitor cocktail	Sigma-Aldrich	Cat# 11697498001
Phosphatase inhibitor cocktail 2	Sigma-Aldrich	Cat# P5726-1ML
Dynabeads protein G Immunoprecipitation Kit	Thermo-Fisher	Cat# 10007D
SuperSignal West Dura Extended Duration Substrate	Thermo-Fisher	CAT# 34076
NuPAGE Novex 4-12% Bis-Tris gradient gel	Invitrogen	Cat# NP0321
GelCode Blue Stain Reagent	Thermo-Fisher	Cat# 24590
FGF-Basic (AA 10-155) Recombinant Human Protein	Thermo-Fisher	Cat# PHG0024
Triton X-100	Merck	Cat# 1086431000
Pyrobest DNA Polymerase	Takara	Cat# R005A
Polybrene infection reagent (10 mg/mL stock = 1,000×)	Merck	Cat# TR-1003-G
Kifunensine class I α-mannosidase inhibitor	Tocris Bioscience	Cat# 3207
16% Formaldehyde solution	Thermo-Fisher	Cat# 28906
VECTASHIELD® Antifade Mounting Medium with DAPI	Vector Laboratories Inc.	Cat# H-1200
Lipofectamine 2000	Thermo-Fisher	Cat# 11668019
Trypsin sequencing grade	Promega	Cat# V5111
10 x Trypsin	PAA	Cat# 11471338
glutaMAX DMEM/F-12	Thermo-Fisher	Cat# 31331-028
Non detergent sulfobetaine (NDSB) 256	Soltec Ventures	CAS No. 81239-45-4
sucrose octasulfate, sodium salt	Toronto Research Chemicals	Cat# S699020-1g
Peptide “TETSQVAPA”	Genscript	Peptide TETSQVAPA
DAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride)	Thermo-Fisher	Cat# D1306
HEPES	Thermo-Fisher	Cat# 15630080
Ampicillin, sodium salt	Sigma-Aldrich	CAS no. 69-52-3
Kanamycin sulfate	Sigma-Aldrich	Cat# 10106801001
3C protease, His-tagged	Purified from BL21 cells transformed with pET28-3C protease plasmid (STRUBI)
Albumin from chick egg white	Sigma-Aldrich	Cat# A5503
NBT/BCIP	Roche	11697471001
NuPAGE LDS sample buffer	Invitrogen	Cat# NP0007
MgCl2	Sigma-Aldrich	CAS no. 7786-30-3
pregnant mare's serum gonadotropin	Biovendor R&D	Cat# RP1782725000
human chorionic gonadotropin	Biovendor R&D	Cat# RP17825010
Entellan	Merck	Cat# 107960
Mowiol	Sigma-Aldrich	Cat# 81381
Critical Commercial Assays
Vectastain Elite ABC kit	Vector laboratories	Cat# PK-7100 RRID:AB_2336827
NeuroTrace 435/455 Blue Fluorescent Nissl Stain	Invitrogen	Cat#N21479
Proximity ligation assay - Duolink in situ red starter kit mouse/RA	Sigma-Aldrich	Cat# DUO92101
Click-It EdU Cell proliferation kit for imaging, Alexa Fluor 555 dye	Thermo-Fisher	Cat# C10338
Deposited Data
Coordinates and structure factors of the ternary NEO1-NET1-RGMB complex determined by X-ray crystallography	This paper	PDB 7NE0
Coordinates and structure factors of the binary NEO1-NET1 complex determined by X-ray crystallography	This paper	PDB 7NE1
Coordinates of the ternary NEO1-NET1-RGMB complex determined by cryo-EM	This paper	PDB 7NDG
Cryo-EM density map of the ternary NEO1-NET1-RGMB complex	This paper	EMD-12286
Raw movies of the dataset for the ternary NEO1-NET1-RGMB complex determined by cryo-EM	This paper	EMPIAR-10637
Experimental Models: Cell Lines
HEK293	Sigma-Aldrich	Cat# 85120602-1VL RRID: CVCL_0045
HEK 293T	ATCC	Cat# CRL-3216; RRID: CVCL_0063
COS-7	ATCC	Cat# CRL-1651; RRID: CVCL_0224
HEK 293T Lenti-X	Takara/Clontech	Cat# 632180
Experimental Models: Organisms/Strains
Mouse: C57BL/6j	Charles River	027 IMSR_JAX:000664
Mouse: Dccfl/fl	Anton Berns (Krimpenfort et al., 2012)	N/A
Mouse: Emx1-IRES-Cre	The Jackson Laboratories	JAX stock # 005628
Mouse: Syn-GFP-Neogenin	This paper	N/A
Mouse: B6CBAF1/Jico	Charles River	N/A
Mouse: Crl:Cd-1(ICR)	Charles River	022
Oligonucleotides
ISH: Net1-forward CGACCTCAATAACCCGCACA	(Brignani et al., 2020)	N/A
ISH: Net1-reverse CTTGCAACGGTCGCATTCAG	(Brignani et al., 2020)	N/A
ISH: NEO1-forward ACACCGTTATCTGGCAATGG	This paper	N/A
ISH: NEO1-reverse TTCAGCAGACAGCCAATCAG	This paper	N/A
genotyping: Neogenin-forward TTAGACCTTGGTCCCACCATGTTCAAGATCCTGCTG	This paper	N/A
genotyping: Neogenin-reverse TCGACCGGTCTTGTCATCGTCATCCTTGTAATCGATATC	This paper	N/A
Recombinant DNA
Plasmid: pCX-GFP	Alain Chédotal (Zelina et al., 2014)	N/A
Plasmid: pCMV-mycDDK-RGMA	Origene	Cat# MR206975
Plasmid: pCAG:mNtn1-/3xGS/mCherry	Custom made at Vector Builder (Brignani et al., 2020)	Vector ID: VB190710-1048nbz
Plasmid: pSuper-shNeogenin	(van Erp et al., 2015)	N/A
Plasmid: pSuper-Scrambled	(van Erp et al., 2015)	N/A
Plasmid: pcDNA3.1-Syn-GFP-Neogenin	This paper	N/A
Plasmid: pCMVXL-6-Neogenin	Gift from Denise Davis	N/A
Plasmid: PCI-Syn-GlyS267Q	Gift from Manfred Kiliman	N/A
Plasmid: pcDNA3.1(-)/myc-his	Invitrogen
Plasmid: pRK5-DR/GABA(A)a1	Gift from Guus Smit	N/A
Plasmid: APtag5-RGMA-AP	Gift from Thomas Skutella	N/A
Plasmid: pcDNA3.1-Netrin-1-AP	Gift from Kun-Liang Guan	N/A
Plasmid: AP-Fc	Gift from Roman Giger	N/A
Plasmid: pHR-CMV-TetO2	(Elegheert et al., 2018)	N/A
Plasmid: pHLsec	(Aricescu et al., 2006)	N/A
Plasmid: pHLsec-eNEO1	(Bell et al., 2013)	N/A
Plasmid: pHLsec-NEOFN56	(Bell et al., 2013)	N/A
Plasmid: pHLsec- RGMAECD	(Bell et al., 2013)	N/A
Plasmid: pHLsec- RGMBECD	(Bell et al., 2013)	N/A
Plasmid: pHLsec- RGMCECD	(Bell et al., 2013)	N/A
Plasmid: pHLsec- RGMBECD-A186R	(Bell et al., 2013)	N/A
Plasmid: pHLsec-RGMBΔN	(Healey et al., 2015)	N/A
Plasmid: pHLsec-NET1ΔNTR	This paper	N/A
Plasmid: pHLsec-NET1FL	This paper	N/A
Plasmid: pHLsec-NET1ΔNTR(Interface-1)	This paper	N/A
Plasmid: pHLsec-NET1ΔNTR(Interface-2)	This paper	N/A
Plasmid: pHLsec-NET1FL(Interface-1)	This paper	N/A
Plasmid: pHLsec-NET1FL(Interface-2)	This paper	N/A
Plasmid: pHLsec- NEOFN456	This paper	N/A
Plasmid: pHLsec- NEO1FL	This paper	N/A
Plasmid: pHLsec- DCCFN56	This paper	N/A
Plasmid: pHLsec- DCCFN456	This paper	N/A
Plasmid: pHLsec- DCCFL	This paper	N/A
Plasmid: pHLsec- RGMBFL	This paper	N/A
Plasmid: pHLsec- RGMBcore	This paper	N/A
Plasmid: pHLsec- RGMBFL-A186R	This paper	N/A
Plasmid: pET28-3C-protease	This paper	N/A
Plasmid: pHR-CMV-TetO2-NET1ΔNTR	This paper	N/A
Software and Algorithms
autoBUSTER	(Bricogne et al., 2011)	https://www.globalphasing.com/buster/
REFMAC5	(Murshudov et al., 2011)	http://www.ccp4.ac.uk/download
PHASER	(McCoy et al., 2007)	http://www.ccp4.ac.uk/download
PDBsum	(Laskowski, 2001)	http://www.ebi.ac.uk/pdbsum
PISA	(Krissinel and Henrick, 2007)	http://www.ebi.ac.uk/pdbe/pisa/
Coot	(Emsley and Cowtan, 2004)	http://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
PyMOL	(Schrodinger, 2010)	https://www.pymol.org/
Consurf	(Ashkenazy et al., 2010)	http://consurf.tau.ac.il/2016/
ATSAS	(Petoukhov et al., 2012)	https://www.embl-hamburg.de/biosaxs/software.html
ScÅtter	(Rambo and Tainer, 2013)	http://www.bioisis.net/
MolProbity	(Davis et al., 2007)	http://molprobity.biochem.duke.edu/
AllosMod-FoXS	(Guttman et al., 2013)	http://modbase.compbio.ucsf.edu/allosmod-foxs/
MultiFoxs	(Schneidman-Duhovny et al., 2016)	https://modbase.compbio.ucsf.edu/multifoxs/
Scrubber2	BioLogic Software	http://www.biologic.com.au/
PRIVATEER	(Agirre et al., 2015a)	https://github.com/agirre/privateer
Sedfit	(Brown and Schuck, 2006)	http://www.analyticalultracentrifugation.com/default.htm
ImageJ	(Schneider et al., 2012)	https://imagej.nih.gov/ij/download.html
Clustal Omega	(Chojnacki et al., 2017)	https://www.ebi.ac.uk/Tools/msa/clustalo/
GraphPad Prism	GraphPad Software	http://www.graphpad.com/scientific-software/prism/
ASTRA 6	Wyatt	https://www.wyatt.com/products/software/astra.html
EPU	FEI	https://www.fei.com/software/epu-automated-single-particles-software-for-life-sciences/
RELION 3.1	(Zivanov et al., 2018)	https://www3.mrc-lmb.cam.ac.uk/relion/index.php/Main_Page
cryoSPARC	(Punjani et al., 2017)	https://cryosparc.com
CTFFIND 4.1	(Rohou and Grigorieff, 2015)	https://grigoriefflab.umassmed.edu/ctffind4
UCSF Chimera	(Goddard et al., 2007)	https://www.cgl.ucsf.edu/chimera/download.html
Phenix	(Afonine et al., 2018)	https://www.phenix-online.org/download/
XIA2	(Winter, 2010)	https://xia2.github.io/
Protein Lynx Global Server software	MatrixScience	http://www.matrixscience.com/help/instruments_masslynx.html#PLGS
Other
TALON® Superflow Metal Affinity Resin	Clontech	Cat# 635668
Biacore T200	GE Healthcare	Cat# 28975001
Sensor Chip CM5	GE Healthcare	Cat# BR100012
CNBr-Activated Sepharose 4B	GE Healthcare	Cat# 17043001
Shodex KW-404 size exclusion column	Shodex (Separation & HPLC) Group	Cat# F6989203
Ultra-thin carbon support film, 3nm-on lacey carbon	Agar Scientific	Cat# AGS187-4
Round filter paper for Vitrobot	Agar Scientific	Cat# 47000-100
Amersham Protran western blotting membranes nitrocellulose	Merck	CAT# GE10600002
Superdex 16/60 200 PG HiLoad	GE Healthcare	Cat# 28989335