KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| DYKDDDDK Tag Antibody (FLAG) | Cell Signaling | Cat#2368S; RRID: AB_2217020 |
| PHD3 Polyclonal Antibody | ThermoFisher Scientific | Cat#PA1-20196; RRID: AB_2096876 |
| Anti-Actin antibody produced in rabbit | Sigma | Cat#A2066; RRID: AB_476693 |
| Acetyl-CoA Carboxylase (C83B10) Rabbit mAb #3676 | Cell Signaling | Cat#C83B10; RRID: AB_2219397 |
| Acetyl-CoA Carboxylase 2 (D5B9) Rabbit mAb #8578 | Cell Signaling | Cat#D5B9; RRID: AB_10949898 |
| Anti-Hydroxyproline antibody (ab37067) | Abcam | Cat#ab37067; RRID: AB_873885 |
| αTubulin Antibody (B-7) | Santa Cruz Biotechnology | Cat#sc-5286; RRID: AB_628411 |
| Rabbit IgG HRP Linked Whole Ab | GE Healthcare/Sigma | Cat#NA934-1ML; RRID: AB_2722659 |
| Mouse IgG HRP Linked Whole Ab | GE Healthcare/Sigma | Cat#NA931-1ML; RRID: AB_772210 |
| InVivoMAb anti-mouse CD3ε, Clone #145-2C11 | BioXCell | Cat#BE0001-1; RRID: AB_1107634 |
| InVivoMAb anti-mouse CD28, Clone #37.51 | BioXCell | Cat#BE0015-1-A050MG; RRID: AB_1107624 |
| InVivoMAb rat IgG2b isotype control, anti-keyhole limpet hemocyanin | BioXCell | Clone: LTF-2; Cat#BE0090; RRID AB_1107780 |
| InVivoMAb anti-mouse CD8α | BioXCell | Clone: 2.43; Cat#BE0061; RRID: AB_1125541 |
| InVivoMAb rat IgG1 Isotype control, anti-trinitrophenol | BioXCell | Clone: TNP6A7; Cat#BE0290; RRID: AB_2687813 |
| InVivoMAb anti-mouse CD8β (Lyt 3.2) | BioXCell | Clone: 53-5.8; Cat#BE0223; RRID: AB_2687706 |
| TruStain FcX™ (anti-mouse CD16/32) Antibody | BioLegend | Clone: 93; RRID: AB_1574973 |
| PE anti-mouse CD45.1 Antibody | BioLegend | Clone: A20; RRID: AB_313496 |
| Alexa Fluor® 647 anti-mouse CD45.2 Antibody | BioLegend | Clone: 104; RRID: AB_492870 |
| APC anti-mouse CD45.2 Antibody | BioLegend | Clone: 104; RRID: AB_389210 |
| Brilliant Violet 421™ anti-mouse CD45.2 Antibody | BioLegend | Clone: 104; RRID: AB_10900256 |
| BUV395 Mouse Anti-Mouse CD45.2 | BD Biosciences | Clone: 104; RRID: RRID: AB_2738867 |
| APC anti-mouse CD3ε Antibody | BioLegend | Clone: 145-2C11; RRID: AB_312676 |
| PE anti-mouse CD3ε Antibody | BioLegend | Clone: 145-2C11; RRID: AB_312672 |
| FITC anti-mouse CD3ε Antibody | BioLegend | Clone: 145-2C11; RRID: AB_312670 |
| Alexa Fluor® 700 anti-mouse CD4 Antibody | BioLegend | Clone: RM4-5; RRID: AB_493701 |
| APC/Cy7 anti-mouse CD4 Antibody | BioLegend | Clone: RM4-5; RRID: AB_312726 |
| BUV737 Rat Anti-Mouse CD4 | BD Biosciences | Clone: RM4-5; RRID: AB_2732918 |
| Pacific Blue™ anti-mouse CD4 | BioLegend | Clone: RM4-5; RRID: AB_493375 |
| Brilliant Violet 421™ anti-mouse CD8α Antibody | BioLegend | Clone: 53-6.7; RRID: AB_10897101 |
| Brilliant Violet 510™ anti-mouse CD8α Antibody | BioLegend | Clone: 53-6.7; RRID: AB_2561389 |
| FITC anti-mouse CD8b Antibody | BioLegend | Clone: YTS156.7.7; RRID: AB_961293 |
| V500 Rat anti-Mouse CD8a | BD Biosciences | Clone: 53-6.7; RRID: AB_1937317 |
| Pacific Blue™ anti-mouse CD8b.2 Antibody | BioLegend | Clone: 53-5.8; RRID: AB_10641278 |
| Alexa Fluor® 700 anti-mouse CD8b Antibody | BioLegend | Clone: YTS156.7.7; RRID: AB_2563948 |
| APC/Cy7 anti-mouse CD8b Antibody | BioLegend | Clone: YTS156.7.7; RRID: AB_2563950 |
| PE/Cy7 anti-mouse/human CD11b Antibody | BioLegend | Clone: M1/70; RRID: AB_312798 |
| V500 Rat anti-CD11b | BD Biosciences | Clone: M1/70; RRID: AB_10893815 |
| Brilliant Violet 510™ anti-mouse/human CD11b Antibody | BioLegend | Clone: M1/70; RRID: AB_2561390 |
| Brilliant Violet 605™ anti-mouse/human CD11b Antibody | BioLegend | Clone: M1/70; RRID: AB_11126744 |
| PerCP/Cy5.5 anti-mouse/human CD44 Antibody | BioLegend | Clone: IM7; RRID: AB_2076206 |
| FITC anti-mouse/human CD44 Antibody | BioLegend | Clone: IM7; RRID: AB_312956 |
| PE anti-mouse/human CD44 Antibody | BioLegend | Clone: IM7; RRID: AB_312958 |
| PE/Cy7 anti-mouse CD62L Antibody | BioLegend | Clone: MEL-14; RRID: AB_313102 |
| FOXP3 Monoclonal Antibody (FJK-16s), eFluor 450; eBioscience™ | ThermoFisher Scientific | Clone: FJK-16s; RRID: AB_1518812 |
| PerCP-Cy™5.5 Mouse anti-Ki-67 | BD Biosciences | Clone: B56; RRID: AB_10611574 |
| FITC anti-human/mouse Granzyme B Antibody | BioLegend | Clone: GB11; AB_2114575 |
| Pacific Blue™ anti-human/mouse Granzyme B Antibody | BioLegend | Clone: GB11; RRID: AB_2562195 |
| PE/Cy7 anti-mouse CD279 (PD-1) Antibody | BioLegend | Clone: RMP1-30; RRID: AB_572016 |
| Brilliant Violet 605™ anti-mouse CD279 (PD-1) Antibody | BioLegend | Clone: 29F.1A12; RRID: AB_11125371 |
| Brilliant Violet 605™ anti-mouse CD19 Antibody | BioLegend | Clone: 6D5; RRID: AB_11203538 |
| PerCP/Cy5.5 anti-mouse CD11c Antibody | BioLegend | Clone: N418; RRID: AB_2129642 |
| APC/Cy7 anti-mouse NK-1.1 Antibody | BioLegend | Clone: PK136; RRID: AB_830870 |
| Ly-6G/Ly-6C Monoclonal Antibody (RB6-8C5), FITC, eBioscience™ | ThermoFisher Scientific | Clone: RB6-8C5; RRID: AB_465314 |
| Pacific Blue™ anti-mouse F4/80 Antibody | BioLegend | Clone: BM8; RRID: AB_893487 |
| Brilliant Violet 421™ anti-mouse CD11c antibody | BioLegend | Clone: N418; RRID: AB_10897814 |
| Alexa fluor® 647 anti-mouse H-2Kb/H-2Db antibody | BioLegend | Clone: 28-8-6; RRID: AB_492931 |
| FITC anti-mouse I-Ab antibody | BioLegend | Clone: AF6-120.1; RRID: AB_313724 |
| PE/Cy7 anti-mouse CD274 (PD-L1) antibody | BioLegend | Clone: 10F.9G2; RRID: AB_10639934 |
| PE anti-mouse CD273 (PD-L2) antibody | BioLegend | Clone: TY25; RRID: AB_2299418 |
| Brilliant Violet® 711 anti-mouse CD40 antibody | BD Biosciences | Clone: 3/23; RRID: AB_2740384 |
| APC anti-mouse IFN-γ antibody | BioLegend | Clone: XMG1.2; RRID: AB_315403 |
| PerCP/Cy5.5 anti-mouse TNF-α antibody | BioLegend | Clone: MP6-XT22; RRID: AB_961435 |
| PE anti-mouse IL-2 | BioLegend | Clone: JES6-5H4; RRID: AB_315301 |
| CD8a Monoclonal Antibody (4SM15) | eBioscience | Cat#14-0808-82; Clone: 4SM15; RRID: AB_2572861 |
| Anti-CD68 antibody | Abcam | Clone: ab125212; RRID: AB_10975465 |
| Recombinant Anti-Lactate Dehydrogenase antibody-Alexa Fluor® 488 | Abcam | Cat#ab202652; Clone: EP1566Y |
| CD4 Monoclonal Antibody (4SM95), eFluor 570 | eBioscience | Cat#41-9766-82; Clone: 4SM95; RRID: AB_2573637 |
| FOXP3 Monoclonal Antibody (FJK-16s), Alexa Fluor 488, eBioscience | eBioscience | Cat#53-5773-82; Clone: FJK-16s; RRID: AB_763537 |
| EOMES Monoclonal Antibody (Dan11mag), PE, eBioscience | ThermoFisher Scientific | Cat#12-4875-82; Clone: Dan11mag; RRID: AB_1603275 |
| Alexa Fluor® 647 anti-mouse Ly-6G Antibody | BioLegend | Clone: 1A8; RRID: AB_1134159 |
| Ki-67 (D3B5) Rabbit mAb (Alexa Fluor® 488 Conjugate) | Cell Signaling | Cat#11882S; Clone: D3B5; RRID: AB_2687824 |
| Anti-CD11b antibody [EPR1344] (Alexa Fluor® 647) | Abcam | Cat#ab204471; Clone: EPR1344 |
| Recombinant Anti-GLUD1 antibody [EPR11370] (Alexa Fluor® 488) | Abcam | Cat#ab204001; Clone: EPR11370 |
| Vimentin (D21H3) XP® Rabbit mAb (Alexa Fluor® 555 Conjugate) #9855 | Cell Signaling | Cat#9855; Clone: D21H3; RRID: AB_10859896 |
| Recombinant Anti-Glucose Transporter GLUT1 antibody [EPR3915] (Alexa Fluor® 647) | Abcam | Cat#ab195020; Clone: EPR3915; RRID: AB_2783877 |
| PCNA (PC10) Mouse mAb (Alexa Fluor® 488 Conjugate) | Cell Signaling | Cat#8580; Clone: PC10; RRID: AB_11178664 |
| Recombinant Anti-COX IV Antibody [EPR9442(ABC)] - Mitochondrial Loading Control (Alexa Fluor® 555) | Abcam | Cat#ab210675; Clone: EPR9442; RRID: AB_2857975 |
| Phospho-mTOR (Ser2448) Monoclonal Antibody, eFluor 660 | eBioscience | Cat#50-9718-41; Clone: MRRBY; RRID: AB_2574351 |
| Recombinant Anti-iNOS antibody [EPR16635] (Alexa Fluor® 555) | Abcam | Cat#ab209594; Clone: EPR16635 |
| Anti-Aconitase 2 antibody [6F12BD9] (Alexa Fluor® 647) | Abcam | Cat#ab198050; Clone: 6F12BD9; RRID: AB_2857971 |
| TCF1/TCF7 (C63D9) Rabbit mAb (Alexa Fluor® 488 Conjugate) | Cell Signaling | Cat#6444S; Clone: C63D9; RRID: AB_2797627 |
| PKM2 (D78A4) XP® Rabbit mAb (PE Conjugate) | Cell Signaling | Cat#89367; Clone: D78A4; RRID: AB_2800137 |
| mTOR (7C10) Rabbit mAb (Alexa Fluor® 647 Conjugate) | Cell Signaling | Cat#5048; Clone: 7C10; RRID: AB_10828101 |
| Recombinant Anti-c-Myc antibody [Y69] (Alexa Fluor® 555) | Abcam | Cat#ab201780; Clone: Y69; RRID: AB_2728791 |
| Anti-VDAC1 / Porin antibody [20B12AF2] (Alexa Fluor® 647) | Abcam | Cat#ab179840; Clone: 20B12AF2 |
| Bacterial and Virus Strains | ||
| Stbl3™ Chemically Competent E. coli | ThermoFisher Scientific | Cat#C737303 |
| Biological Samples | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| DMEM (high glucose, glutamine, no pyruvate) | ThermoFisher Scientific | Cat#11965118 |
| RPMI 1640 Medium | ThermoFisher Scientific | Cat #11875093 |
| 1X DPBS | ThermoFisher Scientific | Cat#14190250 |
| 1X DPBS (calcium, magnesium) | ThermoFisher Scientific | Cat#14040133 |
| Penicillin-Streptomycin | ThermoFisher Scientific | Cat#15140122 |
| Fetal Bovine Serum (FBS) | Sigma | Cat#F2442 Lot#17L189 |
| Charcoal-Stripped Fetal Bovine Serum (FBS) | ThermoFisher Scientific | Cat#A3382101 |
| 2-mercaptoethanol | ThermoFisher Scientific | Cat#21985023 |
| EDTA (0.5 M) | ThermoFisher Scientific | Cat#15575020 |
| HEPES | ThermoFisher Scientific | Cat#15630080 |
| Fugene 6 Transfection Reagent | Promega | Cat#E2691 |
| Hexadimethrine bromide (Polybrene) | Santa Cruz | Cat#sc-255611 |
| Collagenase, Type I | Worthington Biochemical Corporation | Cat#LS004194 |
| Collagenase P | Roche | Cat#11249002001 |
| Percoll density gradient media | GE Healthcare LifeSciences | Cat#17089101 |
| Complete Mini Protease Inhibitor | Sigma | Cat#11836170001 |
| Phosphatase Inhibitor Cocktail 2 | Sigma | Cat#P5726-5ML |
| Phosphatase Inhibitor Cocktail 3 | Sigma | Cat#P0044 |
| Blasticidin | Sigma-Aldrich | Cat#15205 |
| BamH I-HF Restriction Endonuclease | NEB BioLabs | Cat#R3136S |
| Sal I-HF Restriction Endonuclease | NEB BioLabs | Cat#R3138S |
| Xho I Restriction Endonuclease | NEB BioLabs | Cat#R0146S |
| EcoR V-HF Restriction Endonuclease | NEB BioLabs | Cat#R3195S |
| CloneAmp™ HiFi PCR Pre-Mix | Clontech | Cat#639298 |
| Quick Ligation™ Kit | NEB BioLabs | Cat#M2200S |
| TRIzol™ Reagent | ThermoFisher Scientific | Cat#15596018 |
| iScript cDNA Synthesis Kit | BioRad | Cat#1708891 |
| PerfeCTa SYBR® Green FastMix | Quantabio | Cat#101414-270 |
| Buffer RLT | Qiagen | Cat#79216 |
| LB Broth LB | Sigma-Aldrich | Cat#L7275 |
| HCS LipidTOX™ Deep Red Neutral Lipid Stain, for cellular imaging | ThermoFisher Scientific | Cat#H34477 |
| BODIPY™ FL C16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid) | ThermoFisher Scientific | Cat#D3821 |
| Prolong Glass Antifade Mountant | ThermoFisher Scientific | Cat#P36982 |
| Recombinant Mo-se IL-7 (carrier-free)-10 ug | BioLegend | Cat#577802 |
| Ionomycin from Streptomyces conglobatus | Sigma Aldrich | Cat#I9657-1MG |
| GolgiStop™ Protein transport inhibitor | BD Biosciences | Cat#554724 |
| Bovine Serum Albumin (BSA), ≥98%, Fatty Acid-free | MP Biomedicals | Cat#IC15240110 |
| Sodium palmitate | Sigma | Cat#P9767 |
| Sodium oleate | Sigma | Cat#O7501 |
| Critical Commercial Assays | ||
| LIVE/DEAD Fixable Near-IR stain | ThermoFisher Scientific | Cat#L10119 |
| Naive CD8a+ T Cell Isolation Kit, mouse | Miltenyi Biotec | Cat#130-096-543 |
| CD45 MicroBeads, mouse | Miltenyi Biotec | Cat#130-052-301 |
| eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set | ThermoFisher Scientific | Cat#00-5523-00 |
| Fixation/Permeabilization Solution Kit | BD Biosciences | Cat#554714 |
| Direct-zol RNA Miniprep Kit | Zymo Research | Cat#R2050 |
| RNeasy Micro Kit | Qiagen | Cat#74004 |
| Pierce™ BCA Protein Assay Kit | ThermoFisher Scientific | Cat#23227 |
| Western Lightning ECL Pro | Perkin Elmer | Cat#NEL120001EA |
| Cell Trace™ Violet Cell Proliferation Kit, for flow cytometry | ThermoFisher Scientific | Cat#C34557 |
| 10’ Chromium Single Cell 3′ v2 | 10X Genomics | Cat#PN-120267 |
| Chromium Single Cell A Chip Kit | 10X Genomics | Cat#PN-1000009 |
| Chromium i7 Multiplex Kit, 96 rxns | 10X Genomics | Cat#PN-120262 |
| Lipoprotein Lipase Assay Kit (Fluorometric) | Abcam | Cat#ab204721 |
| Deposited Data | ||
| TMT-proteomics of sorted MC38 tumor cells with high-fat diet | This manuscript (ProteomeXchange) | Accession#PXD019495 |
| Raw and analyzed RNA-sequencing data | This paper (GEO repository) | GSE157999 |
| Experimental Models: Cell Lines | ||
| MC38 colorectal adenocarcinoma | Laboratory of D. Vignali, University of Pittsburgh School of Medicine, Pittsburgh, PA | RRID: CVCL_B288 |
| Lewis Lung Carcinoma | N/A | RRID: CVCL_4358 |
| B16.F10 Melanoma | Gift from G. Dranoff (Novartis Institutes for Biomedical Research) | RRID: CVCL_0159 |
| E0771 breast cancer cell line | Corporate Cell Line Sales (CH3 Biosystems) | Cat#94A001; RRID: CVCL_GR23 |
| RENCA kidney renal adenocarcinoma cell line | ATCC | Cat#CRL-2947; RRID: CVCL_2174 |
| CT26 colon carcinoma cell line | N/A | RRID: CVCL_7256 |
| HEK293T | N/A | RRID: CVCL_0063 |
| Phoenix-ECO | ATCC | Cat#CRL-3214; RRID: CVCL_H717 |
| Experimental Models: Organisms/Strains | ||
| C57BL6/J | The Jackson Laboratory | #000664; RRID: IMSR_JAX:000664 |
| TCRa knock-out mice: B6.129S2-Tcratm1Mom/J | The Jackson Laboratory | #002116; RRID: IMSR_JAX:002116 |
| OT-1 mice: C57BL/6-Tg(TcraTcrb)1100Mjb/J | The Jackson Laboratory | #003831; RRID: IMSR_JAX:003831 |
| Oligonucleotides | ||
| Cloning mouse PHD3-OE vector with C-terminal
FLAG: Fwd - CGTAGAGGATCCATGCCTCTGGGACACAT Rev -GGACGCGTCGACCTACTTGTCGTCGTCGTCCTTGTAGTCGATGTCGTGGTCCTTGTAGTCACCGTCGTGGTCCTTGTAGTCGTCTTTAGCAAGAGCA |
This manuscript | N/A |
| Cloning RFP to generate MSCV-PIR: Fwd - cttccgctcgagATGGCCTCCTCCGAGGACG Rev - gattcggatatcTTAGGCGCCGGTGGAGTG |
This manuscript | N/A |
| PHD3 qPCR Primers (mouse): Fwd - CAGACCGCAGGAATCCACAT Rev - TTCAGCATCGAAGTACCAGACAGT |
German et al., 2016 | N/A |
| β-Actin qPCR Primers
(mouse): Fwd - AGCCATGTACGTAGCCATCC Rev - CTCTCAGCTGTGGTGGTGAA |
German et al., 2016 | N/A |
| Recombinant DNA | ||
| pCMV-SPORT6 Egln3 (Phd3) | Harvard PlasmID Database | MmCD00320451 |
| MSCV-PIG (Retroviral vector containing puromycin-IRES-GFP) | Addgene | Addgene#18751 |
| MSCV-PIR (Retroviral vector containing puromycin-IRES-RFP) | This manuscript | N/A |
| pLenti CMV GFP Blast (659-1) | Addgene | Addgene#17445 |
| pLenti CMV Phd3 Blast (C-terminal FLAG-tag) | This manuscript | N/A |
| Software and Algorithms | ||
| GraphPad Prism V7 | GraphPad Software | https://www.graphpad.com |
| FlowJo 10.4.1 | FlowJo LLC | https://www.flowjo.com |
| CLC Genomics Workbench Version 8.0.1 | Qiagen | https://www.qiagenbioinformatics.com/products/clc-genomics-workbench/ |
| GEPIA (Gene Expression Profiling Interactive Analysis) | Laboratory of Z. Zhang, Peking University, Beijing Shi, China | http://gepia.cancer-pku.cn/ |
| GenePattern | Broad Institute | https://www.genepattern.org/ |
| Other | ||
| PicoLab® Rodent Diet 20 | LabDiet | Cat#5053 |
| Rodent Diet With 60 kcal% Fat | Research Diets | Cat#D12492 |
| GentleMACS C Tubes | Miltenyi | Cat#130-093-237 |
| Criterion TGX gel 4-20% | BioRad | Cat#5671095 |
| Nitrocellulose Membrane 0.2uM | BioRad | Cat#162-0112 |
| Lithium Heparin Tubes (2 mL) | VWR | Cat#454237 |
| MICROVETTE CB300 EDTA/PK100 | Sarstedt Inc | Cat#NC9141704 |
| Nylon Net Filters | EMD Millipore | Cat#NY2004700 |