Table 1.
Primer Name | Sequence (5′-3′) | Cycling Conditions (°C/min) a | Purposes |
---|---|---|---|
wbaP_KKBO-1_AvaI | TAACGCTCGAGCGGTGTCCCAGTAAAAGG | D(94/1) A(52/1) E(72/1) | Cloning in pGEM-T-Easy®; Sequencing |
wbaP_KKBO-1_EcoRI | AAGCAGAATTCACGCCAAATATCACCACCAT | Cloning in pGEM-T-Easy®; Sequencing | |
Seq_wbaP_fwd | GTGATGGCGGTGTTCCTG | Sequencing; Screening | |
Seq_wbaP_rev | GGTAGCCACGACAAATC | Sequencing; Screening | |
pACYC184_ExtSeq_Ava | GCTAACGGATTCACCACT | Sequencing; Screening | |
pACYC184_ExtSeq_EcoRIrev | CCTTTATTCACATTC | Sequencing; Screening |
a D stands for denaturation, A stands for annealing, and E stands for extension. All reactions include an initial denaturation step of 5 min at 94 °C and a final extension step of 5 min at 72 °C.