Skip to main content
. 2021 Apr 17;9(4):865. doi: 10.3390/microorganisms9040865

Figure 4.

Figure 4

Schematic representation of CRISPR-2 locus in S. Typhimurium. The direction of spacers and repeats is shown, 5’ → 3’, with respect to the leader region (orange rectangle). The palindromic repeats (CGGTTTATCCCCGCTGGCGCGGGGAACAC) are shown as black horizontal lines. A distinctly coloured diamond represents each spacer. Strains DP_F10, DP_N16, DP_N28, JE_2727, DT104 reference (DT104 ref.), JM_04.26, and R13 harbour the same spacers (n = 26), of which n = 24 (spacers 1–8, 10–25; spacer 9 is a duplicate of spacer 8) are commonly shared with LT2 (DT4). The DT104 strains MC_04-0529 and TM75-404 possess shorter CRISPR-2 arrays, n = 22 and n = 12 spacers, respectively; n = 20 spacers (1–11, 21; spacer 5 is a duplicate of spacer 4) of MC_04-0529 and n = 11 spacers (1–11) of TM75-404 are identical to spacers within the LT2 CRISPR-2 locus. The DT104b reference (DT104b ref.) strain possesses n = 16 spacers, of which n = 7 (spacers 4–9, 15) were unique to DT104b ref. and LT2.