Prognostic value of test(s) for O6‐methylguanine–DNA methyltransferase (MGMT) promoter methylation for predicting overall survival in people with glioblastoma treated with temozolomide

. 2021 Mar 12;2021(3):CD013316. doi: 10.1002/14651858.CD013316.pub2

Study ID	Method	Technique description	Primers used	Antibody/mRNA measurement/enzymatic activity assay	How cut‐off threshold determined
Almuqate 2018	Technique: MS‐RE‐qPCR Sample type: NR CpG sites: NR Threshold: > 5%	MS‐RE‐qPCR	NR	—	Mention of "optimal cut‐off;" unclear whether the 5% cut‐off was prespecified, or whether multiple cut‐offs were investigated
Almuqate 2018	Technique: MS‐RE‐qPCR Sample type: NR CpG sites: NR Threshold: > 9%	MS‐RE‐qPCR	NR	—	Described as "current cut‐off" and "analytically validated"
Bady 2012 (E‐GBM)	Technique: bead array Sample type: frozen CpG sites: 31 and 83 Threshold: > 0.358	Infinium HumanMethylation27 (HM‐27K) BeadChip	NR	—	From M‐GBM dataset
	Technique: bead array Sample type: frozen CpG sites: 78–84 Threshold: > 10%	Infinium HumanMethylation27 beadchip (Illumina Inc.)	NR	—	Selected the threshold that gave the best stratification value according to the log‐rank test
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 7.28%	Methylation‐specific PSQ performed with PyroMark Q96 CpG MGMT kit Qiagen	—	—	"The percentage of MGMT methylation was averaged over the 5 CpG‐sites interrogated… The data was dichotomized into unmethylated and methylated status using an iterative procedure based on segmented regression [5]. The optimal cut‐off obtained was 7.28%, defined as the point where the sum of squares of residuals is minimal."
Bady 2012 (M‐GBM)	Technique: bead array Sample type: frozen CpG sites: 31 and 83 Threshold: > 0.358	Infinium HumanMethylation27 (HM‐27K) BeadChip	NR	—	Threshold derived empirically to maximise sensitivity and specificity: "For classification, we used a probability cut‐off of 0.358, which empirically maximized the sum of sensitivity and specificity."
Bady 2012 (M‐GBM)	Technique: MSP Sample type: NR CpG sites: 76–80 and 84–86 Threshold: NR	"Performed basically as reported by Esteller et al." Esteller M et al. New England Journal of Medicine 2000;343:1350–4.	See Figure 1 of publication	—	NR
Barault 2015	Technique: Methyl‐beaming Sample type: FFPE CpG sites: 79–83 Threshold: > 40.2%	Methyl‐beaming assay. "BEAMing analysis is a multistep digital PCR based technique published by Diehl and colleagues [7]. Its application for methylation is named Methyl‐BEAMing and has been previously described to detect methylation of the VIM gene [5]…The percentage of methylation was calculated dividing the methylated specific signal by the sum of methylated plus unmethylated specific signal." Workflow for methyl‐beaming: bisulfite treatment; locus enrichment; digital PCR; hybridisation flow cytometry	Methyl‐beaming 1st PCR: forward 5'‐TCCCGCGAAATTAATACGACGTTTAGGATATGTTGGGATAGT‐3', reverse 5'‐GCTGGAGCTCTGCAGCTAAACCACCCAAACACTCACCAA‐3'. Methyl‐beaming emulsion PCR: forward 5'‐TCCCGCGAAATTAATACGAC‐3', reverse 5'‐GCTGGAGCTCTGCAGCTA‐3' (Table S2 of publication).	—	"ROC analysis was carried out to evaluate the threshold best fitting the overall survival (OS) at 1 year" on a cohort of 98 participants with GBM diagnosed before TMZ was introduced as a component of standard treatment. The cut‐off was then validated in this cohort of participants.
Barault 2015	Technique: PSQ Sample type: FFPE CpG sites: 76–81 Threshold: > 29.6%	Bisulfite‐PSQ. "Pyrograms were analyzed using PyroMark Q24 Software, average of the 6 CpG sites methylation values was used for further analyses."	Forward 5'‐GTTTAGGATATGTTGGGATAGT‐3', reverse 5'‐GGACACCGCTGATCGTTTAAACCACCCAAACACTCACCAA‐3', universal 5'‐GGGACACCGCTGATCGTTTA‐3', sequencing 5'‐GTTTTTAGAAYGTTTTGYGTTT‐3' (Table S2 of publication)	—
Barbagallo 2014	Technique: MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: including weakly	"MSP assay was performed using a 2‐step nested PCR approach as previously described. The MSP reactions were performed in 25 ml by 2720 Thermal Cycler Applied Biosystem PCR. Universal unmethylated and polymethylated DNA were included as controls in each set of reactions, in addition to a negative control sample without DNA."	Primers from Esteller 1999	—	"Universal unmethylated and polymethylated DNA were included as controls in each set of reactions, in addition to a negative control sample without DNA. Individual tumors showing only very weak PCR products for the methylated MGMT sequence promoter but strong PCR products for the unmethylated MGMT sequence promoter were judged as "weakly methylated"."
	Technique: MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: excluding weakly		Primers from Esteller 1999	—
	Technique: PSQ Sample type: FFPE CpG sites: NR Threshold: > 9%	"Templates for pyrosequencing were amplified with primers that were biotinylated for template strands (MGMT PyroMark CpG Assay kit, Qiagen). The biotinylated polymerase chain reaction (PCR) products were then immobilized on streptavidin‐coated Sepharose beads (GE Healthcare), and the single‐stranded DNA templates were analyzed by PyroMark Q24 (Qiagen)."	Primers from MGMT PyroMark CpG Assay kit, Qiagen	—	NR
	Technique: PSQ Sample type: FFPE CpG sites: NR Threshold: > 25%		Primers from MGMT PyroMark CpG Assay kit, Qiagen	—	NR
Bell 2017	Technique: QF‐IHC (AQUA) Sample type: FFPE CpG sites: N/A Threshold: > median	QF‐IHC (AQUA). Median cut‐off tumour mask. 4 tissue microarrays containing paraffin‐embedded tumour cores from the 452 RTOG 0525 people were cut at 5 µm and sections were placed on positively charged slides. As a surrogate for tumour colocalisation, proteins were colocalised with glial fibrillary acidic protein (DAKO;1:100) to stain the cytoplasmic compartments of glial cells. Deparaffinisation and retrieval were performed as previously described. Slides were scanned by HistoRx PM‐2000 and analysed by AQUAnalysis software. Each protein was scored in the tumour, cytoplasm, and nuclear components of each tissue microarray core using the HistoRxTM AQUA platform and fluorescent IHC.	N/A	Antibody: MGMT (MT3.1) (Santa Cruz; 1:100)	To determine the best cut‐off points for markers with continuous values significantly associated with survival for inclusion in the RPA model, the technique of using ROC curves was applied. Because the area under the ROC curve for all markers was ≤ 0.65, limiting the ability to determine optimal cut points, methods using quartiles, tertiles and medians were used.
Bell 2017	Technique: qMSP Sample type: NR CpG sites: NR Threshold: > 8	qMSP assay (detail from the original NRG RTOG 0525 paper). Performed centrally by Oncomethylome Science – direct, real‐time MSP (RTOG 0525 Gilbert paper references Vlassenbroeck 2008, MSP method taken from Vlassenbroeck. "Validation of Real‐Time Methylation‐Specific PCR to Determine O6‐Methylguanine‐DNA Methyltransferase Gene Promoter Methylation in Glioma"). "Analyte (m_MGMT and β‐actin [ACTB]) quantification was performed by real‐time MSP assays. These consisted of parallel amplification/quantification processes using specific primer and primer/detector pairs for each analyte using the Amplifluor assay format on an ABI Prism 7900HT instrument (Applied Biosystems, Foster City, CA). The analyte defined in the direct, real‐time MSP was the MGMT promoter sequence and detects the fully methylated version. ACTB was used as a reference gene in the assay, using primers that are outside any CpG islands. The Amplifluor direct forward primers are preceded by the detection elements (underlined). The amplicon size is 136 bp for the m_MGMT analyte and 125 bp for the ACTB analyte, including the Amplifluor detection sequence."	See Vlassenbroeck.	—	From Vlassenbroeck paper: "These cutoffs had been defined previously in a smaller data set and are consistent with the present study suggesting the cutoff at ratio value 8."
Brigliadori 2016	Technique: PSQ Sample type: FFPE CpG sites: 74–83 Threshold: > 9%	PSQ. 10 CpG sites of the MGMT promoter (74–83) located in a gene region recognised as critical for transcriptional control (DMR2) were analysed using a PyroMark 96 system (Diatech, Iesi, Italy), according to the manufacturer's protocol. All tumour and control samples were analysed in triplicate. Templates for PSQ were amplified using a Rotorgene 6000 with primers that had been biotinylated for template strands (MGMT plus kit, Diatech, Iesi, Italy). 20 μL of the biotinylated PCR products were then immobilised on streptavidin‐coated Sepharose beads (GE Healthcare, Uppsala, Sweden), and the single‐stranded DNA templates were analysed by PyroMark Q96 system (Diatech, Iesi, Italy). Subsequent quantification of the methylation density for the 10 investigated CpG sites was performed using the PyroMark Q96 software. Methylation percentages for each sample were obtained by calculating the mean of all 10 methylation sites. The median value of the 3 analyses was considered for each methylation level.	Primers that had been biotinylated for template strands (MGMT plus kit, Diatech, Iesi, Italy).	—	References literature
Brigliadori 2016	Technique: PSQ Sample type: FFPE CpG sites: 74–83 Threshold: > 29%			—	References literature
Chai 2018 (7‐site cohort)	Technique: PSQ Sample type: frozen CpG sites: 72–78 Threshold: > 12%	"Bisulfite‐treated DNA was preamplified with the primers (a) F‐primer 5'‐GTT TYG GAT ATG TTG GGA TAG TT‐3'; (b) biotinylated R‐primer 5'‐biotin‐ACR ACC CAA ACA CTC ACC AA‐3'. Different samples were analyzed with two independent assays, and the PSQ primers were (a) 5'‐GAT ATG TTG GGA TAG T‐3' (for CpGs 72–78)… PSQ testing was performed on a PyroMarker Q96 instrument, and the results were analyzed with PyroMarker Q96 software." (Qiagen)	Bisulfite‐treated DNA was preamplified with the primers (a) F‐primer 5'‐GTT TYG GAT ATG TTG GGA TAG TT‐3'; (b) biotinylated R‐primer 5'‐biotin‐ACR ACC CAA ACA CTC ACC AA‐3'. Different samples were analysed with 2 independent assays, and the PSQ primers were (a) 5'‐GAT ATG TTG GGA TAG T‐3' (for CpGs 72–78).	—	"We determined the cutoff in this study by similar strategy, comprehensively considering the ROC likelihood value, sensitivity, specificity, and cutoffs used in reported studies."
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 12%
	Technique: PSQ Sample type: frozen CpG sites: 75–78 Threshold: > 12%
Chai 2018 (8‐site cohort)	Technique: PSQ Sample type: frozen CpG sites: 75–78 Threshold: > 13%	PSQ. CpGs 75–78. "Briefly, bisulfite‐treated DNA was preamplified with the primers (a) F‐primer 5'‐GTT TYG GAT ATG TTG GGA TAG TT‐3'; (b) biotinylated R‐primer 5'‐biotin‐ACR ACC CAA ACA CTC ACC AA‐3'. Different samples were analyzed with two independent assays, and the PSQ primers were…(b) 5'‐GTT TTT AGA AYG TTT TG‐3' (for CpGs 75–82)… PSQ testing was performed on a PyroMarker Q96 instrument, and the results were analyzed with PyroMarker Q96 software." (Qiagen)	Bisulfite‐treated DNA was preamplified with the primers (a) F‐primer 5'‐GTT TYG GAT ATG TTG GGA TAG TT‐3'; (b) biotinylated R‐primer 5'‐biotin‐ACR ACC CAA ACA CTC ACC AA‐3'. Different samples were analysed with 2 independent assays, and the PSQ primers were…(b) 5'‐GTT TTT AGA AYG TTT TG‐3' (for CpGs 75–82).	—	"We determined the cutoff in this study by similar strategy, comprehensively considering the ROC likelihood value, sensitivity, specificity, and cutoffs used in reported studies."
	Technique: PSQ Sample type: frozen CpG sites: 75–82 Threshold: > 12%
	Technique: PSQ Sample type: frozen CpG sites: 76–79 Threshold: > 11%
Dahlrot 2018 (NS cohort)	Technique: DIF Sample type: FFPE CpG sites: N/A Threshold: < 0.2	DIF was performed on FFPE tissue on the Autostainer Plus platform (DAKO Denmark A/S, Glostrup, Denmark). Detection was performed using DAKO CSA II, Biotin‐Free Catalyzed Amplification System (DAKO ref. K1497). Positive controls consisting of tissue cores from different normal and cancer tissues, including 11 high‐grade gliomas, were included in each run.	N/A	Antibody: MT23.2; Invitrogen 1 + 100, CA, USA.	Median value. The AF‐all of all MGMT positive nuclei (defined as the area of all MGMT‐positive nuclei divided by the area of all nuclei), the AF‐t of MGMT‐positive tumour nuclei (defined as the area of MGMT‐positive tumour nuclei divided by the area of all tumour nuclei), and the AF‐nt of MGMT positive non‐tumour nuclei (defined as the area of MGMT positive non‐tumour nuclei divided by the area of all non‐tumour nuclei) were identified. Only the AF‐t of MGMT‐positive tumour nuclei (defined as the area of MGMT positive tumour nuclei divided by the area of all tumour nuclei) was evaluated.
Dahlrot 2018 (NS cohort)	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 9%	PyroMark Q96. MGMT promoter status was determined, measured, established using PSQ (MGMT Pyro kit; Qiagen, Hilden, Germany). A modified PSQ method published by Collins et al. [29] was used. After bisulfite conversion of 50–200 ng of DNA using EZ DNA Methylation Kit (Zymo Research, Irvine, CA, USA), nested PCR was carried out with HotStarTaq Master Mix (Qiagen). Obtained PCR product was used as a template in 4 PSQ assays. PSQ was performed on a PyroMark Q96 MD instrument (Qiagen) using PyroMark Gold Q96 CDT Reagents (Qiagen). as described by the manufacturer.	NR	—	NR
Dahlrot 2018 (RSD cohort)	Technique: DIF Sample type: FFPE CpG sites: N/A Threshold: < 0.2	DIF was performed on formalin fixed paraffin embedded tissue on the Autostainer Plus platform (DAKO Denmark A/S, Glostrup, Denmark). Detection was performed using DAKO CSA II, Biotin‐Free Catalyzed Amplification System (DAKO ref. K1497). Positive controls consisting of tissue cores from different normal and cancer tissues, including 11 high‐grade gliomas, were included in each run.	N/A	Antibody: MT23.2; Invitrogen 1 + 100, CA, USA.	Median value. The AF‐all of all MGMT‐positive nuclei (defined as the area of all MGMT positive nuclei divided by the area of all nuclei), the AF‐t of MGMT‐positive tumour nuclei (defined as the area of MGMT positive tumour nuclei divided by the area of all tumour nuclei), and the AF‐nt of MGMT‐positive non‐tumour nuclei (defined as the area of MGMT‐positive non‐tumour nuclei divided by the area of all non‐tumour nuclei) were identified. Only the AF‐t of MGMT‐positive tumour nuclei (defined as the area of MGMT‐positive tumour nuclei divided by the area of all tumour nuclei) was evaluated.
Dahlrot 2018 (RSD cohort)	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 10%	MGMT promoter status was determined, measured and established using PSQ (MGMT Pyro kit; Qiagen, Hilden, Germany) as described by the manufacturer. DNA was purified from 10 lm paraffin slides using QIAamp DNA FFPE Tissue kit (Qiagen), and MGMT PSQ was performed according to the kit instructions.	NR	—	NR
Dunn 2009	Technique: PSQ Sample type: frozen, smear, FFPE or a combination CpG sites: 72–83 Threshold: > 9%	"The pyrosequencing assay was performed as described earlier (Shaw et al, 2006). The primers used for amplification of bisulphite‐treated DNA were forward: 5'‐gGGATAGTTGGGATAGTT‐3' (the first g avoids formation of hairpin loops) and reverse: 5'‐biotin‐ATTTGGTGAGTGTTTGGG‐3' giving a 99‐bp amplicon at genomic position 131 155 467–131 155 565…pyrosequencing on a PSQ96MA System (Biotage, Uppsala, Sweden) using the primer 5'‐GGATATGTTGGGATAGT‐3' and PyroGold reagents (Biotage). The Pyro Q‐CpG software 1.0.9 (Biotage) was used to analyse data…Pyrosequencing yields data for 12 CpG sites within the MGMT promoter. For data analysis, the percentage methylation obtained for each CpG was averaged across the 12 CpGs in duplicate PCR reactions (average methylation per sample)."	"The primers used for amplification of bisulphite‐treated DNA were forward: 5'‐gGGATAGTTGGGATAGTT‐3' (the first g avoids formation of hairpin loops) and reverse: 5'‐biotin‐ATTTGGTGAGTGTTTGGG‐3' giving a 99‐bp amplicon at genomic position 131 155 467–131 155 565…pyrosequencing on a PSQ96MA System (Biotage, Uppsala, Sweden) using the primer 5'‐GGATATGTTGGGATAGT‐3'."	—	≥ mean ± 2 SD for non‐neoplastic brain
	Technique: PSQ Sample type: frozen, smear, FFPE, or a combination CpG sites: 72–83 Threshold: > 20%				"methylated cases were ranked according to methylation and divided into three groups."
	Technique: PSQ Sample type: frozen, smear, FFPE or a combination CpG sites: 72–83 Threshold: > 29%				"Methylated cases were dichotomised using receiver operator characteristic (ROC) plots comparing average methylation per case with the Cox regression survival function for OS…Receiver operator characteristic analysis used to separate methylated cases into two prognostic groups yielded a cut‐off of 29.4%."
	Technique: PSQ Sample type: frozen, smear, FFPE or a combination CpG sites: 72–83 Threshold: > 35%				"methylated cases were ranked according to methylation and divided into three groups."
	Technique: PSQ Sample type: frozen, smear, FFPE or a combination CpG sites: 72–83 Threshold: cluster 1 vs 2 and 3				"Unsupervised hierarchical cluster analysis of average methylation at each CPG site."
	Technique: PSQ Sample type: frozen, smear, FFPE or a combination CpG sites: 72–83 Threshold: cluster 1 and 2 vs 3
Felsberg 2009	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: < 10%	Negative controls were carried out by omission of the primary antibodies. Each IHC staining was scored blinded to clinical or molecular information. For the assessment of MGMT protein expression, only nuclear staining was considered. Staining of vascular endothelial cells served as an internal positive control. The DAKO catalysed signal amplification horseradish peroxidase system was used as the detection systems according to the manufacturer's protocol to show MGMT expression.	N/A	Antibody: mouse monoclonal antibody MT 3.1 (Dako).	The fraction of immunopositive tumour cells was evaluated semiquantitatively and categorised according to the following immunoreactivity scores: 0, no positive tumour cells; 1, weak expression < 10% positive tumour cells; 2, moderate expression 10–50% positive tumour cells; 3, strong expression > 50% positive tumour cells.
	Technique: MSP Sample type: frozen (14 FFPE) CpG sites: NR Threshold: NR	Methylation‐specific PCR	Methylated MGMT promoter: 5'‐gtttttagaacgttttgcgtttcgac‐3' and 5'‐ caccgtcccgaaaaaaaactccg‐3', amplify a 122‐bp fragment. Unmethylated MGMT promoter sequences were 5'‐tgtgtttttagaatgttttgtgttttgat‐3' and 5'‐ctaccaccatcccaaaaaaaaactcca‐3', amplify a 129‐bp fragment.	—	N/A
	Technique: PCR‐mRNA Sample type: frozen (14 FFPE) CpG sites: N/A Threshold: < 50%	Expression of MGMT transcripts was determined by real‐time reverse transcription‐PCR using the ABI PRISM 5700 sequence detection system (Applied Biosystems). The transcript level of MGMT was normalised to the transcript level of ARF1 (ADP‐ribosylation factor 1, GenBank accession‐no. M36340).	MGMT‐RT‐F, 5'‐tgcacagcctggctgaatg‐3' and MGMT‐RT‐R, 5' ggtgaacgactcttgctggaaa‐3' resulting in a 102‐bp fragment.	mRNA: commercially available adult human brain RNA (BD Biosciences) was used as reference for the mRNA expression.	NR
Havik 2012	Technique: MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: NR	"For MSP, melting curve analysis was used to detect PCR products in our samples (35)…Three replicates of each sample were used to ensure statistical representativity. Real‐time PCR followed by melting curve analysis was run on a CFX96 Touch™ Real‐ Time PCR Detection system (Bio‐Rad Laboratories)…Following the last cycle, PCR products were incubated for 10 s at 95°C before the melting curve was generated by heating from 65°C to 95°C in increments of 0.5°C/5 s while continuously measuring the fluorescence. The melting curves were analyzed using Bio‐Rad CFX Manager Software (Bio‐Rad Laboratories). Melting peaks determined for methylated and unmethylated controls, respectively, were used to identify methylated and unmethylated PCR products in the samples (EpiTect PCR Control DNA Set, cat. number 59695; Qiagen). Samples having only methylated PCR products and samples having both methylated and unmethylated PCR products were both scored as methylation‐positive."	Correspond to those used in Esteller 1999. MSP‐MGMT‐methylated forward 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3', MSP‐MGMT‐methylated reverse 5'‐GCACTCTTCCGAAAACGAAACG‐3', MSP‐MGMT‐unmethylated forward 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3', MSP‐MGMT‐unmethylated reverse 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3'.	—	"Samples having only methylated PCR products and samples having both methylated and unmethylated PCR products were both scored as methylation‐positive."
	Technique: PCR‐HRM Sample type: frozen CpG sites: 72–83 Threshold: NR	"Three replicates of each sample were used…Real‐time PCR followed by a melting curve step was run on a CFX96 Touch Real‐Time PCR Detection system (Bio‐Rad Laboratories)…The melting curve step was performed according to the company's recommendation (Bio‐Rad Laboratories)…The data files generated by the CFX96 system were imported using Precision Melt Analysis software (Bio‐Rad Laboratories) and further analyzed."	MGMT MS‐HRM2‐forward 5'‐GCGTTTCGGATATGTTGGGATA‐3', MGMT MS‐HRM2‐reverse 5'‐AACGACCCAAACACTCACCAAA‐3'	—	NR
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 2.68%	PSQ using the PyroMark MD System (Qiagen). Bisulfite‐treated DNA was amplified in a PCR reaction using primers from the PyroMark Q96 CpG MGMT kit (part number 972032, Qiagen).	NR	—	"The pyrosequencing threshold was determined from the mean methylation value in the five analyzed CpG sites and the mean standard deviation (X + 2SD) in the four meningiomas. Glioma samples were scored as methylation positive by pyrosequencing if all five CpG sites had methylation values higher than the resulting threshold of 2.68%."
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 6%	"PyroMark Q96 CpG MGMT kit (cat. number 972032; Qiagen) and the PyroMark MD system (Qiagen)."	PyroMark Q96 CpG MGMT kit (cat. number 972032; Qiagen).	—	"Receiver operating characteristic (ROC) curve analysis was used to estimate the optimal cut‐off value for the two PSQ assays, using the mean percentage MGMT methylation for the CpGs covered by the two assays. The area under the ROC curve (AUROC) was calculated after fitting ordinary logistic regressions with the dependent variable indicating if a patient lived at least 18 months after diagnosis or not. Methylation was included as an independent variable."
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 7%
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 8%
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 9%
	Technique: PSQ Sample type: frozen CpG sites: 76–79 Threshold: > 6%	Thera 6%. PSQ. 6% cut‐off. "PyroMark therascreen MGMT kit (cat. number 971061; Qiagen) and the PyroMark Q24 system (Qiagen)"	PyroMark therascreen MGMT kit (catalogue number 971061; Qiagen)	—	"Receiver operating characteristic (ROC) curve analysis was used to estimate the optimal cut‐off value for the two PSQ assays, using the mean percentage MGMT methylation for the CpGs covered by the two assays. The area under the ROC curve (AUROC) was calculated after fitting ordinary logistic regressions with the dependent variable indicating if a patient lived at least 18 months after diagnosis or not. Methylation was included as an independent variable."
	Technique: PSQ Sample type: frozen CpG sites: 76–79 Threshold: > 7%
	Technique: PSQ Sample type: frozen CpG sites: 76–79 Threshold: > 8%
	Technique: PSQ Sample type: frozen CpG sites: 76–79 Threshold: > 9%
	Technique: qMSP Sample type: frozen CpG sites: 71–73 and 75–86 Threshold: NR	"Quantitation of MGMT promoter methylation assessed by qMSP is described in (34)."	MGMT qMSP forward primer: 5'‐GCGTTTCGACGTTCGTAGGT‐3', reverse primer: 5'‐CACTCTTCCGAAAACGAAACG‐3'. MGMT_1 qMSP forward primer: 5'‐CGAATATACTAAAACAACCCGCG‐3', reverse primer: 5'‐TTTTTTCGGGAGCGAGGC‐3' (as in Havik 2012)	—	Percentage methylated reference 0 (from Havik 2012) (stated "None" in Johannessen 2018) "A threshold value for scoring methylation positive samples was defined based on the qMSP result of four meningiomas, which all had PMR values of zero in both qMSP assays." (from Havik 2012)
	Technique: qMSP Sample type: frozen CpG sites: 71–86 Threshold: > 0%	MGMT promoter methylation was quantitatively assessed by 2 qMSP assays, each covering 11 CpG sites (CpGs). The 2 assays analysed CpGs in partially overlapping regions (Additional file 1: Figure S1), but detected methylation on opposite DNA strands. Primers (Medprobe) and 6‐FAM labelled minor groove binder (MGB) probes (Applied Biosystems, Life Technologies) were modified from 2 previously reported assays.	qMSP: forward primer GCGTTTCGACGTTCGTAGGT; reverse primer CACTCTTCCGAAAACGAAACG MGMT_1 qMSP: forward primer CGAATATACTAAAACAACCCGCG; reverse primer TTTTTTCGGGAGCGAGGC ALU qMSP: forward primer GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA; reverse primer ATTAACTAAACTAATCTTAAACTCCTAACCTCA.	—	"Samples with a Ct‐value above 35 were censored (resulting in a quantity of 0). The percentage of methylated reference (PMR) was calculated for each sample from the median quantity value from the triplicates by dividing the MGMT/ALU quantity ratio in the target by the MGMT/ALU quantity ratio in the methylated control, and multiplying by 100. A threshold value for scoring methylation positive samples was defined based on the qMSP result of four meningiomas, which all had PMR values of zero in both qMSP assays. Only samples with a PMR value above zero in both assays were scored as methylation positive."
Hsu 2017 (see Hsu 2015)	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: < 10%	"Tissue sections were immunostained on BOND‐MAX immunostainer (Leica Microsystems). Normal brain was used as external positive control, a previously proven MGMT methylated GBM was used as negative control."	N/A	Antibody: clone MT3.1 (1:100; Thermo, Fremont, CA)	The staining intensity of endothelial cells was used as a reference for interpretation of positive or negative staining of tumour cells. Positive MGMT staining (IHC+) was defined as > 10% of tumour nuclei with the staining intensity similar to or slightly weaker than that of the adjacent endothelial cells (Fig. 1A). Negative MGMT staining was defined as staining that did not fulfil the positive criteria.
	Technique: MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: NR	1‐step MSP was performed as previously described (Hsu 2013).	Unmethylated: USP‐F1 5' TTTGTGTTTTGATGTTTGTAGGTTTTTGT 3' and USP‐R1 5' AACTCCACACTCTTCCAAAAACAAAACA 3'; methylated: were MSP‐F1 50 TTTCGACGTTCGTAGGTTTTCGC 30 and MSP‐R1 5' GCACTCTTCCGAAAACGAAACG 3'.	—	Serial dilutions of the positive control were performed and the lowest concentration of methylated DNA to have a PCR product was 0.5%. MSP of each sample, including DNA extraction and bisulfite modification, was performed in duplicates in accompany with 100%, 0.5%, and 0% methylated DNA as positive, cut‐off, and negative controls in each run. Samples with PCR products of any intensity were regarded as a positive result, whereas those with no PCR products were negative for MSP.
	Technique: PSQ Sample type: FFPE CpG sites: 76–79 Threshold: > 5%	"The methylation status of 4 CpG sites within MGMT promoter region (genomic sequence on chromosome 10 from 131,265,519 to 131,265,537: CGACGCCCGCAGGTCCT CG) was analyzed by therascreen MGMT Pyro Kit (Qiagen GmbH)."	Primers from the MGMT Pyro Kit.	—	According to the recommendation by the manufacturer.
	Technique: qMSP Sample type: FFPE CpG sites: 77–80 and 84–87 Threshold: > 0.04%	"The qMSP was performed using QuantiTect SYBR Green PCR Kit (Qiagen GmbH, Hilden, Germany) as previously described (Hsu 2015)."	Methylated MGMT‐F1 5' TTTCGACGTTCGTAGGTTTTCGC 3', methylated MGMT‐R1 5' GCACTCTTCCGAAAACGAAACG 3'.	—	Median value based on results of the assay.
	Technique: qMSP Sample type: FFPE CpG sites: 77–80 and 84–87 Threshold: > 0.1%			—	Based on authors previous data.
Karayan‐Tapon 2010	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: < 15.5%	Percentage of positive cells was determined in the most highly stained areas of each tumour section by counting ≥ 200 contiguous cells. All tumoural cells with nuclear immuno‐staining (high or low intensity) were counted as positive.	N/A	Antibody: MT3.1 (Novus Biologicals)	Median value used as cut‐off.
	Technique: MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: NR	"The methylation status of the CpG island of MGMT promoter was determined using two‐stage PCR [32]."	Study references Palmisano et al. Cancer Research 60:5954–8 which in turn references Esteller et al. 1999. Primers for stage 1 (amplification) from Palmisano et al. 2000 MGMT‐forward, 5'‐GGATATGTTG GGATAGTT‐3'; and MGMT‐reverse, 5'‐CCAAAAACCCCAAACCC‐3'. Primers for stage 2 from Esteller et al. 1999: Primer sequences for the unmethylated reaction were 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse primer), and for the methylated reaction they were 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse primer).	—	NR
	Technique: PCR‐mRNA Sample type: frozen CpG sites: N/A Threshold: < 0.39	Quantitative real‐time PCR. "RNA (1 μg) was reversed‐transcribed using the Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). The relative expression of MGMT was quantified using the Applied Biosystems TaqMan FAM‐labeled probes for MGMT and three housekeeping genes: 18S, RPLPO, and GAPDH. The expression of MGMT in tumors was compared with the expression of MGMT in PBMC (unmethylated DNA) by the 2^‐ΔΔCt method [34] using the average Ct of the three housekeeping genes for normalization."	N/A	mRNA: "RNA (1 μg) was reversed‐transcribed using the Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). The relative expression of MGMT was quantified using the Applied Biosystems TaqMan FAM‐labeled probes for MGMT and three housekeeping genes: 18S, RPLPO, and GAPDH. The expression of MGMT in tumors was compared with the expression of MGMT in PBMC (unmethylated DNA) by the 2^‐ΔΔCt method [34] using the average Ct of the three housekeeping genes for normalization."	Median value used as cut‐off.
	Technique: PSQ Sample type: frozen CpG sites: 74 Threshold: > 5.5%	PSQ. CpG 1. "The pyrosequencing methylation assay was performed with the PyroMarkTM MGMT kit (Biotage, Uppsala, Sweden) on a PSQTM96 MA system (Biotage, Uppsala, Sweden), according to the manufacturer's protocol. The PyroMarkTM MGMT kit detects the level of methylation of five CpG sites located in the first exon of the MGMT gene."	PyroMarkTM MGMT kit (Biotage, Uppsala, Sweden).	—	Median value used as cut‐off.
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 8.0%
	Technique: PSQ Sample type: frozen CpG sites: 75 Threshold: > 8.7%
	Technique: PSQ Sample type: frozen CpG sites: 76 Threshold: > 8.0%
	Technique: PSQ Sample type: frozen CpG sites: 77 Threshold: > 7.85%
	Technique: PSQ Sample type: frozen CpG sites: 78 Threshold: > 7.8%
	Technique: SQ‐MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: > 35	SQ‐MSP. "Amplifications were carried out on an MX4000 instrument with the Brilliant SYBR Green Core kit (Stratagene, La Jolla, CA) or on an Applied Biosystems ABI‐PRISM 7900 with the Applera SYBR Green master mix (Applied Biosystems, Foster City, CA). Methylation index (MI) was calculated using a modification of the formula proposed by Fackler et al.: %M = 100 – [(CtM/ CtM + CtUM) × 100] [33]."	Study references Palmisano et al. Cancer Research 60:5954–8 which in turn references Esteller et al. 1999. Primers for stage 1 (amplification) from Palmisano et al. 2000 MGMT‐forward, 5'‐GGATATGTTG GGATAGTT‐3'; and MGMT‐reverse, 5'‐CCAAAAACCCCAAACCC‐3'. Primers for stage 2 from Esteller et al. 1999: Primer sequences for the unmethylated reaction were 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse primer), and for the methylated reaction they were 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse primer).	—	Median value used as cut‐off.
Kim 2016	Technique: MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: NR	SQ‐MSP. FFPE, 12% cut‐off. "sqMSPCR was performed with primers specific for either "methylated" or "unmethylated" DNA. Forward primers were labeled at their 5' end with a fluorescent reporter dye (FAM), as previously described [17]. The PCR products corresponding to the "methylated" sequences have a size of 82bp while the "unmethylated" sequences have 12 additional nucleotides (94bp). Both fragments were amplified in the same reaction and PCR products were analyzed by capillary electrophoresis. Estimation of the amount of methylated DNA was calculated with the following formula, abbreviations are as follows; MF‐ "methylated" fraction, UM‐"unmethylated" fraction: (peak height of the MF/peak height of the UM + MF) × 100." Reference 17: Nguyen et al. Current Cancer Drug Targets 2015;15:624–40.	Study references Palmisano WA et al. Cancer Research 60:5954–8 which in turn references Esteller et al. 1999. Primers for stage 1 (amplification) from Palmisano et al. 2000 MGMT‐forward, 5'‐GGATATGTTG GGATAGTT‐3'; and MGMT‐reverse, 5'‐CCAAAAACCCCAAACCC‐3'. Primers for stage 2 from Esteller et al. 1999: Primer sequences for the unmethylated reaction were 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse primer), and for the methylated reaction they were 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse primer).	—	NR
Kim 2016	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 9%	PSQ. "The PyroMark Q96 CpG MGMT kit5,10) (Ensembl ID: OTTHUMT00000051009) (Qiagen, Hilden, Germany)…PyroGold reagents were used for the PSQ reaction, and the signal was analyzed using the PSQ 96MA System (Biotage, Uppsala, Sweden). Target CpGs were evaluated by PSQ96MA 2.1 instrument software (Biotage, Uppsala, Sweden)."	PyroMark Q96 CpG MGMT kit (Ensembl ID: OTTHUMT00000051009) (Qiagen, Hilden, Germany).	—	"Receiver operating characteristic (ROC) curve analysis was used to determine the cut‐off value of mean percentage of methylation at the five CpGs for predicting the longer survival3). The area under the ROC curve (AUC) was used to determine the optimal threshold of the mean percentage of the methylation at the five CpGs."
Kristensen 2016	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: at 0%	"Formalin‐fixed, paraffin‐embedded sections were deparaffinized in xylene and rehydrated in decreasing concentrations of ethanol; Immunoreactivity was visualized with DAB + (DAKO K3468) as chromogen. The immunohistochemical reactions were semiquantitatively evaluated according to the number of tumor cells stained; For MGMT evaluation, positive endothelial cells, lymphocytes, and microglia served as positive internal controls."	N/A	Antibody: monoclonal mouse anti‐human antibody against MGMT (MAB16200, 1:200, Millipore)	NR
	Technique: PSQ Sample type: frozen CpG sites: NR Threshold: > 10%	Standard PSQ. "PCR and pyrosequencing were performed using the Therascreen (R) MGMT Pyro (R) kit according to the manufacturer's instructions with slight modifications."	Supp Fig 1	—	NR
	Technique: qMSP‐PSQ Sample type: frozen CpG sites: NR Threshold: > 0.1%	qMSP‐PSQ. Quantitative and allelic methylation analyses were performed using qMSP and melting analyses followed by PSQ of methylation‐positive samples being heterozygous for the rs16906252 SNP. Flowchart of method in Fig 1 of the publication. Sodium bisulfite conversion of the samples was performed using the EZ DNA Methylation kit (Zymo Research) according to the manufactures' instructions, with slight modifications; samples were incubated at 42 °C for 30 minutes instead of 37 °C for 15 minutes. For the bisulfite reaction the alternative incubation conditions described in the appendix were used. The LightCycler 480 (Roche Life Science) was used for real‐time PCR and melting analysis. The real‐time PCR cycling protocol started with one cycle of 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 20 seconds, 70 °C for 20 seconds, 72 °C for 20 seconds. The melting step was performed from 65 °C to 95 °C after a denaturation step of 1 minute at 95 °C and a hybridization step of 40 °C for 1 minute. For the reaction mixtures the SYBR Green Master Mix (Roche) was used at a final concentration at 1×. Final primer concentrations were 200 nM of each primer, and 25 ng of DNA was used as template. The final reaction volume was 20 μL. Primer sequences have been published previously. The Alu assay used for normalisation was used without the TaqMan probe using an intercalating fluorescent dye instead as previously described. PSQ was performed on the PyroMark Q24 (Qiagen) using the PyroMark Gold Q24 reagents (Qiagen), according to the manufactures' instructions.	Supp Fig 1	—	This technical cut‐off was defined following an evaluation of a serial dilution series of methylated DNA into unmethylated.
	Technique: qMSP‐PSQ Sample type: frozen CpG sites: NR Threshold: > 5%
	Technique: qMSP‐PSQ Sample type: frozen CpG sites: NR Threshold: > 20%
Lalezari 2013	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: < 30%	"MGMT immunoreactivity was semi‐quantitatively assessed by counting the immunostained tumor nuclei as a percentage of the total tumor nuclei…All immunohistochemical analyses were performed blinded to methylation status and clinical information."	N/A	Antibody: MT3.1 (Millipore)	Median value used as cut‐off.
	Technique: MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: NR	MGMT methylation analysis was performed by MSP according to a previously published protocol with slight modifications. Samples were subjected to a 2‐stage nested PCR strategy using 2 sets of primers.	First‐stage primers (5'‐GGATATGTTGGGATAGTT‐3' and 5'‐CCAAAAACCCCAAACCC‐3') and second‐stage primers (unmethylated reaction: 5'‐TTTGTGTTTTGATGTTTGTA‐GGTTTTTGT‐3' and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3'; methylated reaction: 5_‐TTTCGACGTTCGTAGGTTTTCGC‐3' and 5'‐GCACTCTTCCGAAAACGAA‐ACG‐3').	—	NR
	Technique: PSQ Sample type: FFPE CpG sites: 72–95 Threshold: NR	Bisulfite‐modified DNA, generated by the method described above, was used to sequence a portion of the MGMT promoter contiguous with and inclusive of the MSP region. Samples were sequenced with a 2‐stage nested PCR using the same first‐stage primers as those that were used in MSP: 5'‐GGATATGTTGGGATAGTT‐3' and 5'‐CCAAAAACCCCAAACCC‐3', and second stage primers 5'‐GGATATGTTGGGATAGTT‐3' and 5'‐CACCTAAAAAACACTTAAAAC‐3'. The sequence of each sample was determined using Chromas Lite 2.33 (Technelysium Pty Ltd). There did not appear to be any significant difference in yield compared to MSP.	First‐stage primers as those that were used in MSP: 5'‐GGATATGTTGGGATAGTT‐3’ and 5'‐CCAAAAACCCCAAACCC‐3', and second stage primers 5'‐GGATATGTTGGGATAGTT‐3' and 5'‐CACCTAAAAAACACTTAAAAC‐3'.	—	Median number of methylated CpG sites used as the threshold defining hypomethylated (< 3 sites) and hypermethylated (≥ 3 sites)
Lattanzio 2015	Technique: MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: NR	MSP using "primers amplifying the exon 1 region of the MGMT gene including the CpG island and subsequently the specific primers for either methylated or unmethylated DNA established by Esteller et al (12). Primers used in the first PCR reaction were: 5'‐GGATATGTTGGGATAGTT‐3' (forward primer, GenBank accession number AL355531, nucleotides 46891 to 46908) and 5'‐CCAAAAACCCCAAACCC‐3' (reverse primer, GenBank accession number AL355531, nucleotides 47162 to 47179) amplifying a 289‐bp fragment…Frozen and FFPE tissue samples were analyzed in triplicate." DNA extracted from snap‐frozen samples.	"primers amplifying the exon 1 region of the MGMT gene including the CpG island and subsequently the specific primers for either methylated or unmethylated DNA established by Esteller et al (12). Primers used in the first PCR reaction were: 5'‐GGATATGTTGGGATAGTT‐3' (forward primer, GenBank accession number AL355531, nucleotides 46891 to 46908) and 5'‐CCAAAAACCCCAAACCC‐3' (reverse primer, GenBank accession number AL355531, nucleotides 47162 to 47179) amplifying a 289‐bp fragment." Primers from Esteller et al. 1999: primer sequences for the unmethylated reaction were 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse primer), and for the methylated reaction they were 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse primer).	—	"the results were qualitatively interpreted as follows: a visible band in the M primer set and absence of the U primer set product indicated a positive methylation status, whereas absence of a M primer set product and presence of a band in the U primer set was evaluated as a negative methylation status."
	Technique: MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: NR	MSP using "primers amplifying the exon 1 region of the MGMT gene including the CpG island and subsequently the specific primers for either methylated or unmethylated DNA established by Esteller et al (12). Primers used in the first PCR reaction were: 5'‐GGATATGTTGGGATAGTT‐3' (forward primer, GenBank accession number AL355531, nucleotides 46891 to 46908) and 5'‐CCAAAAACCCCAAACCC‐3' (reverse primer, GenBank accession number AL355531, nucleotides 47162 to 47179) amplifying a 289‐bp fragment…Frozen and FFPE tissue samples were analyzed in triplicate." DNA extracted from snap‐frozen samples.	"primers amplifying the exon 1 region of the MGMT gene including the CpG island and subsequently the specific primers for either methylated or unmethylated DNA established by Esteller et al (12). Primers used in the first PCR reaction were: 5'‐GGATATGTTGGGATAGTT‐3' (forward primer, GenBank accession number AL355531, nucleotides 46891 to 46908) and 5'‐CCAAAAACCCCAAACCC‐3' (reverse primer, GenBank accession number AL355531, nucleotides 47162 to 47179) amplifying a 289‐bp fragment." Primers from Esteller et al. 1999: primer sequences for the unmethylated reaction were 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse primer), and for the methylated reaction they were 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse primer).	—	"the results were qualitatively interpreted as follows: a visible band in the M primer set and absence of the U primer set product indicated a positive methylation status, whereas absence of a M primer set product and presence of a band in the U primer set was evaluated as a negative methylation status."
	Technique: PSQ Sample type: FFPE CpG sites: 72–80 Threshold: ≥ 9%	DNA extracted from FFPE samples. "PSQ was performed using the PyroMark ID System (Biotage, Uppsala, Sweden). The PSQ primers used for amplification of bisulfite‐treated DNAs were designed to cover a region including 9 CpG sites of the MGMT promoter at the beginning of the first exon, adjacent to the region covered by MSP primers (specifically, CpGs 5–6–7–8–9 in the pyrograms corresponded to CpGs included in specific M/U MSP primers). The primers were 5'‐GGATATGTTGGGATAGTT‐3' (forward primer, GenBank accession number AL355531, nucleotides 46891 to 46908) and 5'‐biotin‐ ACCCAAACACTCACCAAA‐3' (reverse primer, GenBank accession number AL355531, nucleotides 46972 to 46990), which amplified a 99‐bp region…PSQ using the forward primer as sequencing primer…Resulting data were analyzed and quantified with PyroMark CpG Software (Biotage)…All samples were analyzed in duplicate."	5'‐GGATATGTTGGGATAGTT‐3' (forward primer, GenBank accession number AL355531, nucleotides 46891 to 46908) and 5'‐biotin‐ ACCCAAACACTCACCAAA‐3' (reverse primer, GenBank accession number AL355531, nucleotides 46972 to 46990). Forward primer also used as the sequencing primer.	—	"To determine the methylation cutoff value for PSQ analysis, we extracted DNA from a pool of 5 normal brain tissues derived from autopsies; the average percentage of methylation of the 5 samples was 8%; thus we considered methylated any tumor sample carrying ≥9% methylation."
	Technique: PSQ Sample type: frozen CpG sites: 72–80 Threshold: ≥ 9%	DNA extracted from snap‐frozen samples. PSQ performed as above.		—
Lechapt‐Zalcman 2012	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: < 15%	Immunostaining was performed using heat‐induced epitope retrieval, pH 9.0, a labelled method (EnVision Kit; Dako SA, Trappes, France), and automate immunostainer (Dako SA) according to the manufacturer's protocol. Negative controls consisted of omitting the primary antibody and replacing it with an irrelevant antibody of similar isotype. Endothelial staining was used as an internal positive control. A pathologist who was blind to the people' clinical and MGMT methylation data independently evaluated MGMT staining using a light microscope at 400 magnification. Specimens without valid internal positive controls were excluded from the analysis. For each specimen, 5–10 images of representative fields were then acquired at 400 magnification. 360–1790 tumour cells were counted in specimen, and the percentage of positive tumour nuclei was calculated. Endothelial and inflammatory cells were excluded from the cell counts.	N/A	Antibody: a mouse primary antibody against MGMT (clone MT3.1; Chemicon International, Temecula, Calif) was used at 1:200 dilution. mRNA: NA	This cut‐off was the median value of reactivity in the GBM series.
Lechapt‐Zalcman 2012	Technique: MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: NR	MSP was performed using a 2‐step approach. Bisulfite modification of genomic DNA was undertaken by means of the Epitect Kit (Qiagen SA) according to the manufacturer's recommendation. PCR amplification was carried out as described by Esteller et al. PCR products were loaded onto 5% agarose gels, stained with GelRed (Interchim, Montlucon, France), and observed under ultraviolet illumination.	5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer) and 5'‐AACTCCACACTCTTCCAAAAA CAAAACA‐3' (reverse primer) for the unmethylated product and 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer) and 5'‐GCACTCTTCCGAAAACGAAA CG‐3' (reverse primer) for the methylated product.	—	N/A
McDonald 2013	Technique: MSP Sample type: FFPE CpG sites: 76–80 Threshold: NR	(From Estellar et al., 1999) 1 μg of DNA was denatured by sodium hydroxide and modified by sodium bisulfite. DNA samples were then purified using Wizard DNA purification resin (Promega), again treated with sodium hydroxide, precipitated with ethanol, and resuspended in water. Controls without DNA were performed for each set of PCRs. Each PCR reaction (10 μL) was directly loaded onto nondenaturing 6% polyacrylamide gels, stained with ethidium bromide, and visualised under ultraviolet illumination.	Primer sequences of MGMT were for the unmethylated reaction 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (upper primer) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (lower primer) and for the methylated reaction 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (upper primer) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (lower primer)	—	NR
McDonald 2013	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 8%	PSQ. Tumour DNA (500 ng) was bisulphite modified using the EZ DNA methylation kit (Zymo Research, Orange CA) according to the manufacturer's recommendations. The CpG PSQ methylation assay was performed with the PyroMark MGMT kit (Qiagen) on a PSQe96 MA system (Qiagen) according to the manufacturer's protocol. Methylation was quantified using the Pyromark CpG software (Qiagen).	NR	—	Determined through a series of segmented regressions where the CpG PSQ values were regressed against their rank order. The model with the cut‐off of 8% CpG PSQ resulted in the minimum mean square error and was thus chosen (Supplementary Fig 1).
Melguizo 2012	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: < 25%	Immunostaining was performed using the Bond Polymer Refine Detection system (Leica Microsistemas S.L.U, Barcelona, Spain). Readings were taken automatically with the ACIS III DAKO system for quantification IHC and were verified by 2 experienced pathologists.	N/A	Antibody: 1:50; Santa Cruz Biotechnology, incmRNA: NA	NR
Melguizo 2012	Technique: MSP Sample type: NR CpG sites: 76–80 and 84–87 Threshold: NR	Methylation patterns in the CpG island of MGMT were determined by chemical modification of unmethylated, but not methylated, cytosine to uracil.	5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer) and 5'‐AACTCCACACTCTTCCAAAAA CAAAACA‐3' (reverse primer) for the unmethylated product and 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer) and 5'‐GCACTCTTCCGAAAACGAAA CG‐3' (reverse primer) for the methylated product.	—	NR
Nguyen 2015	Technique: FSQ‐MS‐PCR Sample type: frozen or FFPE CpG sites: 76–80 and 84–87 Threshold: > 15%	FSQ‐MS‐PCR was using specific primers in a semiquantitative multiplexed fluorescent MS‐PCR.	Unmethylated cytosines, were 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer, UF) and 5'‐AACTCCACACTCTTCCAAAAAC AAAACA‐3' (reverse primer, UR), and the specific primers for methylated cytosines were 5'‐TTTCGACGTTCGTA GGTTTTCGC‐3' (forward primer, MF) and 5'‐GCACTCTT CCGAAAACGAAACG‐3' (reverse primer, MR).	—	Outcome‐based approach used. Assessed effect of multiple cut‐off points on survival and determined the cut‐off point with the best statistical significance (p value) and the ones associated with the shortest and longest survivals.
Nguyen 2015	Technique: FSQ‐MS‐PCR Sample type: frozen or FFPE CpG sites: 76–80 and 84–87 Threshold: > 60%			—
Park 2011	Technique: MS‐MLPA Sample type: 50% frozen and 50% FFPE CpG sites: NR Threshold: > 0.1%	Used MS‐MLPA probe mix prepared by MRC‐Holland (Salsa MS‐MLPA Kit ME011 MMR), which included 3 probes specific for the MGMT promoter region containing a HhaI recognition site. The procedure was performed according to the manufacturer's protocol. HhaI (R6441; Promega), a methylation‐sensitive restriction enzyme that cuts unmethylated GCGC sites was applied to each set of samples. The resultant PCR fragments were separated by capillary gel electrophoresis (ABI Prism 7000/7700, Applied Biosystems). The methylation status was quantified using GeneMarker software (version 1.5, Soft Genetics). To compensate for the differences in the efficiency of the PCR for the individual samples, the peak value of each probe was normalised by dividing it by the peak of the control probes. To evaluate the methylation status, the methylation ratio was calculated by the mean of dividing each normalised peak value of the digested sample by that of the corresponding undigested sample. This value corresponds to the percentage of methylated sequences.	NR	—	Outcome‐based approach: chose the best cut‐off to predict early‐response evalution (progression/pseudoprogression).
	Technique: MS‐MLPA Sample type: 50% frozen and 50% FFPE CpG sites: NR Threshold: > 0.2		NR	—
	Technique: MSP Sample type: 50% frozen and 50% FFPE CpG sites: 76–80 and 84–86 Threshold: NR	The obtained PCR products were electrophoresed in 2% agarose gels and visualised under ultraviolet illumination after staining with ethidium bromide. For the evaluation of the assay results, the products from the controls were examined first. The MGMT gene promoter fragments in the controls were observed at 80 and 92 bp for the methylated DNA–methylated primer and unmethylated DNA–unmethylated primer combinations, respectively. The methylated DNA–unmethylated primer and unmethylated DNA–methylated primer controls were not expected to show any bands. If the control results were acceptable, participant samples were evaluated for the presence of amplification with the methylated and unmethylated primers.	The primer sequences for the MGMT were as follows: methylated forward: 5'‐TTT CGA CGT TCG TAG GTT TTC GC‐3', methylated reverse: 5'‐GCA CTC TTC CGA AAA CGA AAC G‐3', unmethylated forward: 5'‐TTT GTG TTT TGA TGT TTG TAG GTT TTT GT‐3', unmethylated reverse: 5'‐AAC TCC ACA CTC TTC CAA AAA CAA AAC A‐3'.	—	NR
Quillien 2014 (test)	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: < 23%	References Chinot et al. Journal of Clinical Oncology 2007;25:1470–5. Percentage of positive tumour cells determined by a pathologist.	N/A	Antibody: MT‐1; Chemicon, Temecula, CA (From Chinot et al. Journal of Clinical Oncology 2007;25:1470–5, NR in Quillien 2012)	"Optimal risk cutoffs were therefore determined as the threshold values of the continuous distribution that best separated low‐ and high‐risk people according to their outcomes (outcome based method). More precisely, they were defined as the thresholds that optimized the area under the receiver operating characteristic (ROC) curve obtained with a Cox model 25 using overall survival (OS) adjusted for age and Karnofsky score (the proportional hazard assumption was checked)."
	Technique: MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: NR	2‐stage PCR	Study references Karayan‐Tapon et al. Journal of Neuro‐oncology 2010;97:311–22, which in turn references Palmisano et al. Cancer Research 20;60:5954–8 which in turn references Esteller et al. 1999. Primers for stage 1 (amplification) from Palmisano et al. 2000 MGMT‐forward, 5'‐GGATATGTTG GGATAGTT‐3'; and MGMT‐reverse, 5'‐CCAAAAACCCCAAACCC‐3'. Primers for stage 2 from Esteller et al. 1999: primer sequences for the unmethylated reaction were 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse primer), and for the methylated reaction they were 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse primer).	—	NR
	Technique: MethyLight‐MSP Sample type: frozen CpG sites: 75–86 Threshold: > 0	MethyLight. Paper cites Metellus P et al. Cancer 2009;115:4783–94. "real‐time, fluorescence‐based polymerase chain reaction (PCR) was performed using the Light Cycler 480 (Roche Diagnostics, Meylan, France). Bisulfite‐converted genomic DNA was amplified using a set of primers and a fluorescent dye‐labeled oligonucleotide probe, resulting in a semiquantitative methylation analysis." In Quillien 2012: "The differences in amounts of input genomic DNA were normalized by the collagen type II, alpha 1 gene (COL2A1). The percentage of methylated reference was calculated as follows: the methylated MGMT/COL2A1 ratio for each sample was divided by the same ratio obtained for a SssI‐treated genomic DNA used as standard, and values were multiplied by 100."	References Widschwendter et al. Cancer Research 2004;64:3807–13. Forward primer sequence 5'‐GCGTTTCGACGTTCGTAGGT‐3', reverse primer sequence 5'‐CACTCTTCCGAAAACGAAACG‐3'	—	"Optimal risk cutoffs were therefore determined as the threshold values of the continuous distribution that best separated low‐ and high‐risk people according to their outcomes (outcome based method). More precisely, they were defined as the thresholds that optimized the area under the receiver operating characteristic (ROC) curve obtained with a Cox model 25 using overall survival (OS) adjusted for age and Karnofsky score (the proportional hazard assumption was checked)."
	Technique: PCR‐HRM Sample type: frozen CpG sites: 70–83 Threshold: > 50%	"PCR amplification and high‐resolution melting analysis were performed using a Mx3000P apparatus (Stratagene, La Jolla, Calif)…(forward: 5' GCGTTTCGGATATGTTGGGATAGT 3' and reverse: 5' AACGACCCAAACACTCACCAAA 3')…After amplification, a postamplification melting curve program was initiated by heating to 95°C for 1 minute, cooling to 70°C for 30 seconds, and increasing the temperature to 95°C (heating rate 0.01°C/s) while continuously measuring fluorescence. Control DNAs were extracted from blood. The methylated control was obtained by treatment with CpG Methylase M.sssI M0226S (New England Biolabs, Ipswich, Mass). Sample melting curves were compared with control melting curves obtained with unmethylated and methylated controls. When the peak corresponding to methylated DNA was >50% of the peak corresponding to unmethylated DNA, the sample was considered methylated. All reactions were performed in duplicate."	Forward: 5'‐GCGTTTCGGATATGTTGGGATAGT‐3', reverse: 5'‐AACGACCCAAACACTCACCAAA‐3'.	—	Melting‐curve method. "When the peak corresponding to methylated DNA was >50% of the peak corresponding to unmethylated DNA, the sample was considered methylated."
	Technique: PSQ Sample type: frozen CpG sites: 74 Threshold: > 4%	"Pyrosequencing was performed with the PyroMark Q96 MGMT kit (Qiagen, Courtaboeuf, France) on a PSQTM96 MA system (Biotage, Uppsala, Sweden)."	PyroMark Q96 MGMT kit (Qiagen, Courtaboeuf, France) used.	—	"Optimal risk cutoffs were therefore determined as the threshold values of the continuous distribution that best separated low‐ and high‐risk people according to their outcomes (outcome based method). More precisely, they were defined as the thresholds that optimized the area under the receiver operating characteristic (ROC) curve obtained with a Cox model 25 using overall survival (OS) adjusted for age and Karnofsky score (the proportional hazard assumption was checked)."
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 8%
	Technique: PSQ Sample type: frozen CpG sites: 75 Threshold: > 11%
	Technique: PSQ Sample type: frozen CpG sites: 76 Threshold: > 4%
	Technique: PSQ Sample type: frozen CpG sites: 77 Threshold: > 6%
	Technique: PSQ Sample type: frozen CpG sites: 78 Threshold: > 5%
	Technique: PSQ Sample type: frozen CpG sites: 74 Threshold: > 8%	Assay for CpG 74–83. Templates for PSQ were prepared by amplifying bisulfite modified DNA with a forward primer (GTTTYGGATATG TTGGGATAG) and a biotinylated reverse primer (AAAA CCACTCRAAACTACCAC). PSQ was performed using PyroGold Q96 SQA Reagents and the Pyro Q‐CpG software on a PyroMark ID pyrosequencer (Qiagen, Crawley, UK) as per manufacturer's recommendation. Full details for CpG location and PSQ can be found in Malley et al. [6] and Mullolland et al. [11].	"forward primer (GTTTYGGATATGTTGGGATAG) and a biotinylated reverse primer (AAAACCACTCRAAACTACCAC). Two assays were designed and run on this template using two PSQ primers: GAT‐AGTTYGYGTTTTTAGAA (assay for CpGs 74–83) andGYGATTTGGTGAGTGTTTG (assay for CpGs 84–89)."	—	"For each of the 16 tested CpG, as well as for the mean of consecutive selected CpGs, optimal risk cut‐off was determined as the threshold value of the continuous distribution which best discriminates low‐ and high‐risk people according to their outcomes (outcome‐based method). these values were defined as the thresholds that optimized the area under the ROC curve obtained with a Cox model [12] using overall survival (OS) and progression‐free survival (PFS) adjusted for age and Karnofsky score (the proportional hazard assumption was checked)."
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 9%
	Technique: PSQ Sample type: frozen CpG sites: 74–89 Threshold: > 11%
	Technique: PSQ Sample type: frozen CpG sites: 75–79 Threshold: > 8%
	Technique: PSQ Sample type: frozen CpG sites: 76 Threshold: > 5%
	Technique: PSQ Sample type: frozen CpG sites: 76–79 Threshold: > 8%
	Technique: PSQ Sample type: frozen CpG sites: 76–80 Threshold: > 9%
	Technique: PSQ Sample type: frozen CpG sites: 77 Threshold: > 7%
	Technique: PSQ Sample type: frozen CpG sites: 77–81 Threshold: > 8%
	Technique: PSQ Sample type: frozen CpG sites: 78 Threshold: > 4%
	Technique: PSQ Sample type: frozen CpG sites: 78–82 Threshold: > 9%
	Technique: PSQ Sample type: frozen CpG sites: 79 Threshold: > 7%
	Technique: PSQ Sample type: frozen CpG sites: 79–83 Threshold: > 8%
	Technique: PSQ Sample type: frozen CpG sites: 80 Threshold: > 4%
	Technique: PSQ Sample type: frozen CpG sites: 81 Threshold: > 8%
	Technique: PSQ Sample type: frozen CpG sites: 82 Threshold: > 16%
	Technique: PSQ Sample type: frozen CpG sites: 83 Threshold: > 10%
	Technique: PSQ Sample type: frozen CpG sites: 84 Threshold: > 9%
	Technique: PSQ Sample type: frozen CpG sites: 84–88 Threshold: > 17%
	Technique: PSQ Sample type: frozen CpG sites: 84–89 Threshold: > 22%
	Technique: PSQ Sample type: frozen CpG sites: 85 Threshold: > 5%
	Technique: PSQ Sample type: frozen CpG sites: 85–89 Threshold: > 13%
	Technique: PSQ Sample type: frozen CpG sites: 86 Threshold: > 11%
	Technique: PSQ Sample type: frozen CpG sites: 87 Threshold: > 25%
	Technique: PSQ Sample type: frozen CpG sites: 88 Threshold: > 4%
	Technique: PSQ Sample type: frozen CpG sites: 89 Threshold: > 12%
Quillien 2014 (validation)	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 9%	Assay for CpG 74–83. PSQ performed using PyroGold Q96 SQA Reagents and the Pyro Q‐CpG software on a PyroMark ID pyrosequencer (Qiagen, Crawley, UK) as per manufacturer's recommendation.	Forward primer (GTTTYGGATATG TTGGGATAG) and a biotinylated reverse primer (AAAA CCACTCRAAACTACCAC).	—	This was the optimal risk cut‐off in the initial population of 89 participants with GBM.
	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 10%
	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 28%
Quillien 2016	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 6%	FFPE, 6% cut‐off. "PSQ was performed as previously described [10, 12] using the PyroMark CpG MGMT kit (ref. 972032, Qiagen, France). All assays were performed in duplicate and each result was averaged together. The average percentage of the 5 CpGs tested was considered."	PyroMark CpG MGMT kit (ref. 972032, Qiagen, France).	—	Optimised cut‐off (current series/frozen samples). "Optimal risk cut‐offs were determined as previously described with age and performance status introduced as adjustment factors [10]." Reference 10: Quillien et al. Cancer 2012;118:4201–11.
	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 8%				Optimised cut‐off (previous series/frozen samples).
	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 12%				Best level of concordance between frozen and FFPE samples.
	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 13%				Best level of concordance between frozen and FFPE samples.
	Technique: PSQ Sample type: FFPE CpG sites: 74–78 Threshold: > 16%				Optimised cut‐off (current series/frozen samples). "Optimal risk cut‐offs were determined as previously described with age and performance status introduced as adjustment factors [10]." Reference 10: Quillien et al. Cancer 2012; 118:4201–11.
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 6%
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 8%				Optimised cut‐off (previous series/frozen samples)
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 12% or 13%				Best level of concordance between frozen and FFPE samples
	Technique: PSQ Sample type: frozen CpG sites: 74–78 Threshold: > 12%	PSQ cut‐off 12% (Qiagen kit) Hs_MGMT_01_PM PyroMark CpG assay (ref 970032 and 972032).	PyroMark CpG assay (ref 970032 and 972032).	—	The mean of the methylation at the 4 CpG sites as predefined in previous study (Quillien 2014)
	Technique: PSQ Sample type: frozen CpG sites: 74‐78 Threshold: > 16%	PSQ. Frozen, 16% cut‐off. "PSQ was performed as previously described [10, 12] using the PyroMark CpG MGMT kit (ref. 972032, Qiagen, France). All assays were performed in duplicate and each result was averaged together. The average percentage of the 5 CpGs tested was considered."	PyroMark CpG MGMT kit (ref. 972032, Qiagen, France).	—	Optimised cut‐off (current series/frozen samples). "Optimal risk cut‐offs were determined as previously described with age and performance status introduced as adjustment factors [10]." Reference 10: Quillien et al. Cancer 2012; 118:4201–11.
	Technique: PSQ Sample type: frozen CpG sites: 76–79 Threshold: > 8%	Therascreen MGMT Pyro Kit (ref. 971061, Qiagen, France) according to the manufacturer's instructions.	N/A	—	The mean of the methylation at the 4 CpG sites as predefined in previous study (Quillien 2014)
	Technique: PSQ Sample type: frozen CpG sites: 76–79 Threshold: > 12%		N/A	—
	Technique: SQ‐MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: > 12%	SQ‐MSP. FFPE, 12% cut‐off. "sqMSPCR was performed with primers specific for either "methylated" or "unmethylated" DNA. Forward primers were labeled at their 5' end with a fluorescent reporter dye (FAM), as previously described [17]. The PCR products corresponding to the "methylated" sequences have a size of 82bp while the "unmethylated" sequences have 12 additional nucleotides (94bp). Both fragments were amplified in the same reaction and PCR products were analyzed by capillary electrophoresis. Estimation of the amount of methylated DNA was calculated with the following formula, abbreviations are as follows; MF‐ "methylated" fraction, UM‐"unmethylated" fraction: (peak height of the MF/peak height of the UM + MF) × 100." Reference 17: Nguyen et al. Current Cancer Drug Targets 2015;15:624–40.	"The technique is using specific primers in a semi‐quantitative multiplexed fluorescent MS‐PCR. Primer sequences recognizing unmethylated cytosines were 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward primer, UF) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse primer, UR), and the specific primers for methylated cytosines were 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward primer, MF) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse primer, MR). The analyzed sequences were designed to target the distal part of the CpG island region of MGMT promoter, whose complete methylation has been correlated with MGMT promoter silencing in cancer cell lines and primary tumors [18]. Primers were labeled at their 5' end with a fluorescent reporter dye (FAM)." From: Nguyen et al. Current Cancer Drug Targets 2015;15:624–40.	—	Best level of concordance between frozen and FFPE samples.
	Technique: SQ‐MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: > 13%				Best level of concordance between frozen and FFPE samples.
	Technique: SQ‐MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: > 23%				Optimised cut‐off (current series/FFPE samples). "Optimal risk cut‐offs were determined as previously described with age and performance status introduced as adjustment factors [10]." Reference 10: Quillien V et al. Cancer 2012;118:4201–11.
	Technique: SQ‐MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: > 13%				Optimised cut‐off (current series/frozen samples) and best level of concordance between frozen and FFPE samples. "Optimal risk cut‐offs were determined as previously described with age and performance status introduced as adjustment factors [10]." Reference 10: Quillien et al. Cancer 2012;118:4201–11.
	Technique: SQ‐MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: > 23%				Optimised cut‐off (current series/FFPE samples). "Optimal risk cut‐offs were determined as previously described with age and performance status introduced as adjustment factors [10]." Reference 10: Quillien V et al. Cancer 2012;118:4201–11.
Thon 2017	Technique: MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: NR	Bisulfite conversion of 200–400 ng DNA was performed with the EpiTect Bisulfite Kit (Qiagen) as described previously.	2 pairs of primers, each specific for either the methylated or the unmethylated MGMT promoter region, were used as originally described by Esteller and colleagues.	—	NR
Thon 2017	Technique: sequencing Sample type: frozen CpG sites: 75–99 (unclear) Threshold: > 50%	Taken from Eigenbrod 2014: "The sequencing reaction covers a 316 bp region of the MGMT promoter with 25 CpG sites, including those detected by MSP (corresponding to CpG positions 2–14)."	—	—	"The MGMT promoter was considered "methylated" when more than half of the CpG sites (≥13 of the 25 CpG sites) were found to be "methylated" or "partially methylated." A "partially methylated" CpG site was defined as the cytosine peaks being 50 % or more of the corresponding thymine peak. Positions with cytosine peaks as small as 10–50 % of the thymine peak were considered weakly methylated. When 9 – 12 of 25 CpG sites were "methylated/partially methylated" the MGMT promoter was considered "partially" methylated. When more than 9 of the 25 CpG sites were "methylated/partially methylated" the MGMT promoter was considered not methylated." "Sequencing of bisulfite‐modified DNA indicated a methylated promoter when more than half of the CpG sites (13 of 25 CpG sites) were found to be methylated; partial methylation was defined as the cytosine and thymine peaks being equally sized or the cytosine peak being twice as high as the corresponding thymine peak."
Yamashita 2018	Technique: MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: NR	"Converted DNA was subjected to MS‐PCR using 2 primer pairs designed for the amplification of methylated and unmethylated alleles of the MGMT promoter…Amplified products were loaded on 16% polyacrylamide gels and visualized under ultraviolet light using ethidium bromide staining."	"The primer sequences for unmethylated reactions was 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward), 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse); for methylated reactions it was 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward), 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse)."	—	Samples with 5% methylation featured a faint positive band, suggesting that the appropriate cut‐off value for MS‐PCR was 5%.
	Technique: PCR‐HRM Sample type: frozen CpG sites: 72–89 Threshold: > 5%	StepOne system (Thermo Fisher Scientific). "MS‐HRM data were analyzed using HRM software (version 3.0.1, Thermo Fisher Scientific). Output plots were produced as aligned melting curves…The area under the curve (AUC) was calculated from the aligned melting curves using ImageJ (NIH); linear regression was applied to interpolate unknown samples from the standards…All measurements were performed in triplicate."	"The primers sets were 5'‐GCGTTTCGGATATGTTGGGATAGT‐3' (forward), 5'‐CCTACAAAACCACTCGAAACTACCA‐3' (reverse) primer 1."	—	Validation of ROC analysis.
	Technique: PCR‐HRM Sample type: frozen CpG sites: 72–89 Threshold: > 8%				Validation of ROC analysis.
	Technique: PCR‐HRM Sample type: frozen CpG sites: 72–89 Threshold: > 10%				From ROC analysis.
	Technique: PCR‐HRM Sample type: frozen CpG sites: 72–89 Threshold: > 12%				Validation of ROC analysis.
	Technique: PCR‐HRM Sample type: frozen CpG sites: 72–89 Threshold: > 15%				Validation of ROC analysis.
Yang 2012	Technique: IHC Sample type: FFPE CpG sites: N/A Threshold: < 10%	"Staining for MGMT protein on primary tumor samples was performed using anti‐MGMT antibody clone MT3.1 (Abcam, Cambridge, England)…To calculate the MGMT labeling index of MGMT‐positive cells, the number of immunoreactive tumor cells was determined for at least 1,000 cells in randomly selected fields."	N/A	Antibody: MT3.1 (Abcam, Cambridge, UK).	NR
Yang 2012	Technique: MSP Sample type: FFPE CpG sites: 76–80 and 84–87 Threshold: NR	"The converted DNA was subjected to methylation‐specific PCR using two primer sets designed for amplifying the methylated or unmethylated allele of the MGMT promoter…Amplified products were separated on a 3% agarose gel and visualized under UV illumination."	"The primer sequences of MGMT for the unmethylated and methylated reactions were as follows: 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3' (forward) and 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3' (reverse); and 5'‐TTTCGACGTTCGTAGGTTTTCGC‐3' (forward) and 5'‐GCACTCTTCCGAAAACGAAACG‐3' (reverse), respectively."	—	NR
Yoshioka 2018	Technique: SQ‐MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: > 0	Brilliant II SYBR Green qPCR Master Mix and 2 types of primers were used for MSP.	Corresponded to those used in Esteller 1999. mMGMT forward5'‐TTTCGACGTTCGTAGGTTTTCGC‐3', mMGMTreverse 5'‐GCACTCTTCCGAAAACGAAACG‐3', uMGMT forward 5'‐TTTGTGTTTTGATGTTTGTAGGTTTTTGT‐3', and uMGMT reverse 5'‐AACTCCACACTCTTCCAAAAACAAAACA‐3'.	—	Based on Delta Ct values "The ΔCt values of the tumors having no peak at 81° C in dissociation curve were between 4 and 10;" "The smaller the ΔCt value is, the greater the proportion of methylated cells and the greater the extent of the methylated region in each cell. Therefore, we set five cutoffs."
	Technique: SQ‐MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: > 2
	Technique: SQ‐MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: > 4
	Technique: SQ‐MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: > 6
	Technique: SQ‐MSP Sample type: frozen CpG sites: 76–80 and 84–87 Threshold: > 8
AF: area fraction; bp: base pair; CpG: 5'‐cytosine‐phosphate‐guanine‐3'; DIF: double immunofluorescence; FFPE: formalin‐fixed paraffin‐embedded; GBM: glioblastoma; IHC: immunohistochemistry; MGMT: O⁶‐methylguanine–DNA methyltransferase; mRNA: messenger ribonucleic acid; MS‐MLPA: methylation‐specific multiplex ligation‐dependent probe amplification; MS‐RE‐qPCR: methylation‐specific restriction enzyme quantitative polymerase chain reaction; MSP: methylation‐specific polymerase chain reaction; N/A: not applicable; NR: not reported; PCR: polymerase chain reaction; PCR‐HRM: polymerase chain reaction with high‐resolution melting; PCR‐mRNA: polymerase chain reaction‐messenger ribonucleic acid; PSQ: pyrosequencing; qMSP: quantitative methylation‐specific polymerase chain reaction; qMSP‐PSQ: quantitative methylation‐specific polymerase chain reaction with pyrosequencing; RNA: ribonucleic acid; ROC: receiver operating characteristic; SD: standard deviation; TMZ: temozolomide.