Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Recombinant DNA agent | pFastBac (plasmid) |
Thermo Fisher Scientific | Cat# 10360–014 | |
| Cell line (Spodoptera frugiperda) | Sf9 cells | Expression System | Cat# 94–001S RID:CVCL_0549 |
|
| Strain (Escherichia coli) | DH10Bac Competent Cells | Thermo Fisher Scientific | Cat# 10361012 | Chemically competent cells |
| Protein purification reagent | Strep-Tactin | IBA Lifesciences | Cat# 2-1201-010 | |
| RNA labeling reagent | Sulfo-NHS-ester Cyanine3 | Lumiprobe Corporation | Cat# 21320 | |
| RNA labeling reagent | Sulfo-NHS-ester Cyanine5 | Lumiprobe Corporation | Cat# 23020 | |
| RNA synthesis reagent | Glen Research | http://www.glenresearch.com | Phosphoramidites | |
| Nucleotide | ATP | Thermo Fisher | Cat# R1441 | |
| Nucleotide-analog | ATPγS | Sigma | A-1388–25 MG | |
| Software, algorithm | Origin software package | Origin Lab | Origin Lab Corporation | |
| Fast-mixing device | Stopped-flow system | BioLogic Sciences Instruments | SFM 3000 | |
| Optical filter | Long pass- filter | NewPort | 10LWF-550B | |
| TCSPC fluorescence system | Time-correlated single photon counting (TCSPC) module | PicoQuant | PHR 800 and Picoharp 300 | |
| Sequence-based reagent | 52 nt sense strand for BLT and 3’ ovr dsRNA | This paper | ssRNA | 5’-GGAGGUAGUAGGUUGUAUAGUAGUAAGACCAGACCCUAGACCAAUUCAUGCC-3’ CC= deoxynucleotide |
| Sequence-based reagent | 52 nt antisense strand for BLT dsRNA | This paper | ssRNA | Biotin-5’- GGCAUGAAUUGGUCUAGGGUCUGGUCUUACUACUAUACAACCUACUACCUCC-3’ |
| Sequence-based reagent | 54 nt antisense strand for 3’ovr dsRNA | This paper | ssRNA | Biotin-5-GGCAUGAAUUGGUCUAGGGUCUGGUCUUACUACUAUACAACCUACUACCUCCCC-3’ |
| Sequence-based reagent | Cy3-end labeled 52 nt sense strand | IDT | ssRNA | 5’Cy3-GGAGGUAGUAGGUUGUAUAGUAGUAAGACCAGACCCUAGACCAAUUCAUGCC-3’ CC = deoxynucleotide |