REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Anti-human CD3ε Brilliant Violet 421 (clone SK7) | Biolegend | Cat# 344834; RRID:AB_2565675 |
Anti-human CD8α Alexa Fluor 488 (clone RPA-T8) | Biolegend | Cat# 301021; RRID:AB_2561281 |
Anti-human CD4 PE (clone RPA-T4) | eBioscience | Cat# 12-0049-42, RRID:AB_1582249 |
Anti-human CD45 Brilliant Violet 510 (clone HI30) | Biolegend | Cat# 304036; RRID:AB_2561940 |
Anti-mouse CD16/32 (clone 2.4G2) | Biolegend | Cat# 101301; RRID:AB_312800 |
Anti-human/primate EGF biotinylated | R&D Systems | Cat# BAF236; RRID:AB_356307 |
Streptavidin APC | Biolegend | Cat# 405207 |
Anti-human ErbB1 (ICR62) | Institute of Cancer Research | N/A |
Anti-human ErbB2 (ICR12) | Institute of Cancer Research | N/A |
Anti-human ErbB3/HER-3 PE (clone 1B4C3) | Biolegend | Cat# 324706; RRID:AB_2099569 |
Anti-human ErbB4/Her4 (clone H4.77.16 (Ab77)) | Novus | Cat# NB120-3104; RRID:AB_789269 |
Goat anti-mouse IgG (H+L) highly cross-adsorbed secondary Alexa Fluor Plus 488 | Thermo Fisher Scientific | Cat# A32723; RRID:AB_2633275 |
Goat anti-rat IgG (minimal x-reactivity) APC | Biolegend | Cat# 405407; RRID:AB_315018 |
7-amino actinomycin D | Cayman Chemical Company | Cat# 11397 |
Anti-mouse TER-119 PerCP-Cyanine5.5 (clone TER-119) | Thermo Fisher Scientific | Cat# 45-5921-82; RRID:AB_925765 |
Anti-Hypoxyprobe antibody, PAb2627 | Hypoxyprobe | Cat# HP PAb2627 |
Anti-human CD3 (clone F7.2.38) | Dako | Cat# M7254 |
Rabbit anti-HIF1α monoclonal (clone EP1215Y) | Abcam | Cat# ab51608; RRID:AB_880418 |
Donkey anti-mouse IgG (H+L) Alexa Fluor Plus 488 | Thermo Fisher Scientific | Cat# A32766; RRID:AB_2762823 |
Donkey anti-rabbit IgG (H+L) Alexa Fluor 568 | Thermo Fisher Scientific | Cat# A10042; RRID:AB_2534017 |
Anti-mouse CD4 FITC (clone RM4-5) | eBioscience | Cat# 11-0042-82; RRID:AB_464896 |
Anti-mouse CD8α eFluor 450 (clone 53-6.7) | eBioscience | Cat# 48-0081-82; RRID:AB_1272198 |
Anti-mouse CD3ε PE (clone 145-2C11) | eBioscience | Cat# 12-0031-82; RRID:AB_465496 |
Bacterial and virus strains | ||
Stbl3 E. coli | Thermo Fisher Scientific | Cat# C737303 |
Biological samples | ||
Human blood/T cells | Healthy volunteers | Guy’s and St Thomas’ Research Ethics Committee (REC reference 09/H0804/92) |
Chemicals, peptides, and recombinant proteins | ||
Ficoll-Paque PLUS | GE Healthcare | Cat# GE17-1440-02 |
T4 DNA ligase | Thermo Fisher Scientific | Cat# EL0011 |
RetroNectin recombinant human fibronectin fragment | Takara | Cat# T100B |
Dynabeads human T-activator CD3/CD28 | Thermo Fisher Scientific | Cat# 11131D |
Restriction endonucleases | New England Biolabs | Various, as per this paper |
FuGENE HD transfection reagent | Promega | Cat# E2311 |
Recombinant human IL-4 | PeproTech | Cat# 200-04 |
Proleukin (aldesleukin), human recombinant IL-2 | Clinigen Group | N/A |
Polybrene | Santa Cruz Biotechnology | Cat# NC9840454 |
KiCqStart SYBR green qPCR ReadyMix, with ROX | Sigma-Aldrich | Cat# KCQS02 |
TRIzol reagent | Thermo Fisher Scientific | Cat# 15596026 |
Cobalt(II) chloride | Sigma-Aldrich | Cat# 60818 |
XenoLight D-Luciferin - K+ salt bioluminescent substrate | PerkinElmer | Cat# 122799 |
RediJect coelenterazine h bioluminescent substrate | PerkinElmer | Cat# 760506 |
Collagenase I from Clostridium Histolyticum | Sigma-Aldrich | Cat# C0130 |
DNase I | AppliChem | Cat# A3778 |
Hypoxyprobe 1 Kit Hpi | Hypoxyprobe | Cat# HP1-200Kit |
Dako EnVision + system-HRP (DAB) | Agilent Technologies | Cat# K4010 |
DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) | Thermo Fisher Scientific | Cat# D1306 |
Critical commercial assays | ||
TaqMan gene expression assay | Thermo Fisher Scientific | Cat# 4331182 |
QIAGEN Plasmid Mini, Midi and Maxi Kits | QIAGEN | Cat# 12125, 12145, 12163 |
QIAGEN DNeasy Blood & Tissue Kit | QIAGEN | Cat# 69506 |
Pan T Cell Isolation Kit, human | Miltenyi Biotec | Cat# 130-096-535 |
EXPRESS One-Step Superscript qRT-PCR Kit | Thermo Fisher Scientific | Cat# 11781200 |
Human IL-2 ELISA Ready-SET-Go! Kit, 2. Generation | eBioscience | Cat# 15590997 |
Human IFN-Gamma DuoSet ELISA | R&D Systems | Cat# DY285B |
UltraView Universal DAB Detection Kit | Roche | Cat# 760-500; RRID:AB_2753116 |
UltraView Universal Alkaline Phosphatase Red Detection Kit | Roche | Cat# 760-501 |
Experimental models: cell lines | ||
SKOV3 | ATCC | Cat# HTB-77; RRID:CVCL_0532 |
HN3 | Ludwig Institute for Cancer Research, London | RRID:CVCL_8126 |
HEK293T | ATCC | Cat# CRL-3216; RRID:CVCL_0063 |
Experimental models: organisms/strains | ||
NOD-scid IL2Rγnull (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ) | Charles River | RRID:BCBC_4142 |
Oligonucleotides | ||
gBlocks gene fragments | Integrated DNA Technologies | Various, as per this paper |
GCCTACCAAGAACAACTGGAC | Integrated DNA Technologies | Fwd binds upstream AgeI |
GGCCCTGCCCCCTCGCGCCCCAGCCGCTGGA | Integrated DNA Technologies | Fwd to fuse CD3ζ-ODD |
TCCAGCGGCTGGGGCGCGAGGGGGCAGGGCC | Integrated DNA Technologies | Rev to fuse CD3ζ-ODD |
GACTAATCCGGATCCTCGAGTGGCTGTTACTGGA ATACTGTAACTGTGCTTTGAGG |
Integrated DNA Technologies | Rev to ODD stop XhoI |
CCATGGTGAAGCGTGAGAAAAATG | Integrated DNA Technologies | Fwd to amplify reporter |
CTCGAGTTACTTGTACAGCTCGTCCATGC | Integrated DNA Technologies | Rev to amplify reporter |
GAGAAGGCCGGCGGTGCCCCAGCCGCTGGA | Integrated DNA Technologies | Fwd to fuse Luc-ODD |
TCCAGCGGCTGGGGCACCGCCGGCCTTCTC | Integrated DNA Technologies | Rev to fuse Luc-ODD |
CCTCAAAGCACAGTTACAGTATTCCAGGGAAGCGG AGCTACTAACTTCAG |
Integrated DNA Technologies | Fwd to fuse Luc-ODD-2A |
CTGAAGTTAGTAGCTCCGCTTCCCTGGAATACTGTA ACTGTGCTTTGAGG |
Integrated DNA Technologies | Rev to fuse Luc-ODD-2A |
GCGGGCCTCTTCGCTATTA | Integrated DNA Technologies | Rev clone 9HRE in SFG |
ATCCGCCACAACATCGAG | Integrated DNA Technologies | Fwd clone 9HRE in SFG |
Recombinant DNA | ||
SFG CBG99Luc-P2A-EGFP | This study | P1 |
SFG HRE9 CBG99luc-ODD401-603-P2A-GFP | This study | P20; HypoxiLuc reporter |
SFG 4αβ-2A-T1E-CD28-CD3z-ODD | This study | P22 |
SFG HRE9 4αβ-2A-T1E-CD28-CD3z | This study | P26 |
SFG HRE9 4αβ-2A-T1E-CD28-CD3z-ODD | This study | P23; HypoxiCAR |
Software and algorithms | ||
FlowJo v.10 Software | TreeStar Inc. | https://www.flowjo.com/ |
Prism 6 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
Snapgene | GSL Biotech | https://www.snapgene.com/ |
NIS-Elements Imaging Software | Nikon | https://www.microscope.healthcare.nikon.com/products/software |
R version 3.5.1 | The R Foundation | https://www.r-project.org/ |
Other | ||
Hypoxia incubator chamber | STEMCELL Technologies | Cat# 27310 |
Gas cylinders | BOC | Custom (at indicated gas mixes) |