Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
sgRNA sequences for CRISPR dCas9 induction
| Target | Sequence (5′–3′) | Location (hg19) |
|---|---|---|
| h1b_1 | GCTATTTGCTGATTTGTATTAGG | Chr2: 166128022 166128044 |
| h1b_2 | GAGGATACTGCAGAGGTCTCTGG | Chr 2: 166984479-166984501 |
| h1b_3 | GGAAGGTTGAGAGAGGAGGGGGG | Chr 2: 166984086-166984108 |
| h1b_4 | AGTATCTGCAGTATCATTGCTGG | Chr 2: 166983556 166983578 |
| h1b_5 | GGAAAATTCCATGCTGAGGTTGG | Chr 2: 166983037 166983059 |
| h1b_6 | TGAATGGCCACAGAGATTTACGG | Chr 2: 166982669 166982691 |
