Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | SH-SY5Y | National Centre for Cell Science, Pune, India | https://www.nccs.res.in/index.php/Nationalrepos/Repocellines | Neuroblastoma cell line |
| Recombinant DNA reagent | H72F (plasmid) | This paper | Clone used to generate H72F mutant (page 21) | |
| Recombinant DNA reagent | H121F (plasmid) | This paper | Clone used to generate H72F mutant (page 21) | |
| Recombinant DNA reagent | I113T (plasmid) | Genscript | ||
| Recombinant DNA reagent | G37R (plasmid) | Genscript | ||
| Recombinant DNA reagent | G85R (plasmid) | Genscript | ||
| Sequence-based reagent | H72F_F | Biotech Desk | PCR primer | cctcactttaatcctctatccagaaaattcggtgggccaaagg |
| Sequence-based reagent | H72F_R | Biotech Desk | PCR primer | cctttggcccaccgaattttctggatagaggattaaagtgagg |
| Sequence-based reagent | H121F_F | Biotech Desk | PCR primer | ggccgcacactggtggtctttgaaaaagcagatgactt |
| Sequence-based reagent | H121F_R | Biotech Desk | PCR primer | aagtcatctgctttttcaaagaccaccagtgtgcggcc |
| Commercial assay or kit | QuickChange XL site directed mutagenesis kit | Agilent | Cat# 200516 | |
| Commercial assay or kit | Vybrant MTT cell proliferation assay kit | Invitrogen | Cat# V-13154 | |
| Chemical compound, drug | 1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) | Avanti Polar Lipids Inc. | Cat# 850355 | |
| Chemical compound, drug | 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) | Avanti Polar Lipids Inc. | Cat# 850725 | |
| Chemical compound, drug | 1,2-Dioleoyl-sn-glycero-3-phospho-L-serine (DOPS) | Avanti Polar Lipids Inc. | Cat# 840035 | |
| Chemical compound, drug | Cardiolipin | Avanti Polar Lipids Inc. | Cat# 710335 | |
| Chemical compound, drug | 1,1'-Dioctadecyl-3,3,3',3'-tetramethylindotricarbocyanine iodide (DiIC-18(3)) | Invitrogen | Cat# D3911 | |
| Chemical compound, drug | Isopropyl ß-D-1-thiogalactopyranoside (IPTG) | Sigma Aldrich | Cat# I6758 | |
| Chemical compound, drug | Thioflavin T | Merck | Cat# T3516 | |
| Chemical compound, drug | Calcein AM | Merck | Cat# 17783 | |
| Software, algorithm | OPM server | Orientations of Proteins in Membranes | https://opm.phar.umich.edu/ppm_server | |
| Software, algorithm | AGGRESCAN | AGGRESCAN | http://bioinf.uab.es/aggrescan/ | |
| Software, algorithm | Image J | National Institutes of Health | https://imagej.nih.gov/ij/ | |
| Other | Alexa Fluor 488 C5 maleimide | Invitrogen | Cat# A10254 |