Reagent/Resource	Reference or Source	Identifier or Catalog Number
Experimental Models
Human: A549 cells	ATCC	N/A
Human: Cas9‐stably‐expressing A549 cells (Cas9‐A549)	This paper	N/A
Human: MICU1 KO #1 A549 cells	This paper	N/A
Human: MICU1 KO #2 A549 cells	This paper	N/A
Human: MCU KO #1 A549 cells	This paper	N/A
Human: MCU KO #2 A549 cells	This paper	N/A
Human: HepG2 cells	ATCC	N/A
Human: HEK293A cells	ATCC	N/A
Human: HEK293T cells	ATCC	N/A
Human: Cas9‐stably‐expressing HT‐1080 cells (Cas9‐HT‐1080)	This paper	N/A
Recombinant DNA
pLenti CMV/TO Puro DEST (670‐1)	Addgene	Cat#17293
pLenti CMV/TO Neo DEST	This paper	N/A
pLenti CMV T/O MICU1‐WT‐HA Neo DEST (CDS of NM_001195518.2)	This paper	N/A
pLenti CMV T/O MICU1‐∆EF‐HA Neo DEST	This paper	N/A
pLenti CMV T/O MICU1‐∆DID‐HA Neo DEST	This paper	N/A
pLenti CMV T/O MICU1‐∆DIMER‐HA Neo DEST	This paper	N/A
pLenti CMV T/O MICU1‐∆EMRE‐HA Neo DEST	This paper	N/A
GeCKOv2 human library (A/B)	Addgene	Cat#1000000048
lentiCas9‐Blast	Addgene	Cat#52962
pCMV‐VSV‐G	Addgene	Cat#8454
psPAX2	Addgene	Cat#12260
lentiCRISPRv2	Addgene	Cat#52961
lentiGuide‐Puro	Addgene	Cat#52963
Antibodies
Mouse monoclonal anti‐Actin (Actin; AC‐40)	Sigma‐Aldrich	Cat#A3853
Mouse monoclonal anti‐CCDC109A (MCU; E‐9)	Santa Cruz	Cat#sc‐515930
Rabbit monoclonal anti‐ASK1 (ASK1; EP553Y)	Abcam	Cat#ab45178
Rabbit polyclonal anti‐MICU1	Sigma‐Aldrich	Cat#HPA037480
Rabbit polyclonal anti‐phospho‐ASK (p‐ASK; Thr838 in human ASK1)	Tobiume et al, 2002	N/A
Rat monoclonal anti‐α Tubulin (α Tubulin; YL1/2)	Santa Cruz Biotechnology	Cat#sc‐53029
Oligonucleotides and sequence‐based reagents
Primers for sgRNAs	This paper	Table EV1
Primers for cloning and subcloning	This paper	Table EV1
Primers for qRT‐PCR	Bidaux et al, 2015	Table EV1
Control siRNA (ON‐TARGET plus Non‐targeting siRNA #4, target sequence: 5’‐UGGUUUACAGUUUUCCUA‐3’)	Dharmacon	Cat#D‐001810‐04‐05
MICU1 siRNA #1 (ON‐TARGET plus MICU1 siRNA, target sequence: 5’‐GCAGUUUGGUGGCAUGCUA‐3’)	Dharmacon	Cat#J‐012720‐18
MICU1 siRNA #2 (ON‐TARGET plus MICU1 siRNA, target sequence: 5’‐UCCUCGAAUUUCAGCGUAA‐3’)	Dharmacon	Cat#J‐012720‐19
MCU siRNA #1 (ON‐TARGET plus MCU siRNA, target sequence: 5’‐GUUUUGACCUAGAGAAAUA −3’)	Dharmacon	Cat#J‐015519‐18
MCU siRNA #2 (ON‐TARGET plus MCU siRNA, target sequence: 5’‐GUAAUGACACGCCAGGAAU‐3’)	Dharmacon	Cat#J‐015519‐20
MICU2 siRNA#1 (ON‐TARGET plus MICU2 siRNA, target sequence: 5’‐GCAUCGAGGUUUAUGGGUA‐3’)	Dharmacon	Cat#J‐015468‐17
MICU2 siRNA#2 (ON‐TARGET plus MICU2 siRNA, target sequence: 5’‐UGAGCAAAUGGAACGUAAA‐3’)	Dharmacon	Cat#J‐015468‐18
Control siRNA (Stealth RNAi Negative Control Medium GC Duplex #2)	Invitrogen	Cat#12935‐112
TRPM8 siRNA #1 (Stealth RNAi siRNA, target sequence: 5’‐AGGAGUACUGCAGCCGCCUCAAUAU‐3’)	Invitrogen	Cat#HSS128188
Chemicals, enzymes and other reagents
Antimycin A	Sigma‐Ardrich	Cat#A8674
BAPTA‐AM	Dojindo	Cat#B035
Blastcidin S HCl	Invitrogen	Cat#A1113903
C11‐BODIPY 581/591	Invitrogen	Cat#D3861
Cal‐520 AM	Abcam	Cat#ab171868
Cell Counting Kit‐8	Dojindo	Cat#CK04
Carbonyl cyanide 4‐(trifluoromethoxy) phenylhydrazone (FCCP)	Cayman	Cat#15218
Deferoxiamine	Cayman	Cat#14595
Decylubiquinone (decylQ)	Cayman	Cat#21027
Erastin	Sigma‐Ardrich	Cat#E7781
Ferrostain‐1	Sigma‐Ardrich	Cat#SML0583
FerroFarRed	Gryoukayaku	Cat#GC903‐01
G418	Invitrogen	Cat#10131‐035
Gateway LR Clonase ll Enzyme Mix	Invitrogen	Cat#11791‐100
Hexadimethrine Bromide (Polybrene)	Nakarai tesque	Cat#17736‐44
JC‐1	Cayman	Cat#10009172 or Cat#15003
Lipofectamine 3000 reagent	Invitrogen	Cat#130469
Lipofectamine RNAiMAX	Invitrogen	Cat#13778‐150
Mitoquinone mesylate (mitoQ)	MCH	Cat#HY‐100116A
Puromycin	Gibco	Cat#A11138‐03
Rhod‐2 AM	Abcam	Cat#ab142780
Tetramethyl rhodamine, Ethyl Ester, Perchlorate (TMRE)	Invitrogen	Cat#T669
Pluronic F127	Invitrogen	Cat#31382W
LDH‐Cytotoxic Test	Wako	Cat#299‐50601
Software
MAGeCK (ver. 0.5.9)	Li et al, 2014	https://sourceforge.net/projects/mageck/
FlowCal (ver. 1.2.1)	Castillo‐Hair et al, 2016	https://pypi.org/project/FlowCal/
MAGeCKFlute	Wang et al, 2019	https://bioconductor.org/packages/release/bioc/html/MAGeCKFlute.html
clusterProfiler	Yu et al, 2012	https://bioconductor.org/packages/release/bioc/html/clusterProfiler.html
Other
96‐well imaging microplate with lid	Falcon	Cat# 353219
Varioskan Flash	Thermo Fisher Scientifc
FACSCalibur	BD Biosciences
QuantStadio1 Real‐Time PCR System	ABI