Key resources table.
Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Genetic reagent (Mus musculus) | WT C57BL/6J | Jackson Laboratory | JAX 000664 RRID:IMSR_JAX:000664 |
N/A |
Genetic reagent (Mus musculus) | APN-KO | PMID:16326714 | N/A | N/A |
Genetic reagent (Mus musculus) | ΔGly | PMID:14576179 | N/A | N/A |
Chemical compound, drug | TRIzolTM Reagent | Thermo Fisher | Cat# 15596018 | N/A |
Chemical compound, drug | Insulin | Eli Lilly | Product ID: A10008415 | N/A |
Chemical compound, drug | Dulbecco’s phosphate buffered saline | Sigma-Aldrich | Cat# D806552 | N/A |
Chemical compound, drug | High-fat diet (HFD) | Research Diets | Cat# D12492 | N/A |
Chemical compound, drug | DAPI | Life Technology | Cat# P36941 | N/A |
Chemical compound, drug | Bovine serum albumin | Sigma | Cat# A9418 | N/A |
Commercial assay or kit | Adiponectin ELISA kit | Invitrogen | Cat# EZMADP-60K RRID:AB_2651034 |
N/A |
Commercial assay or kit | Insulin ELISA Jumbo kit | ALPCO | Cat# 80-INSMS-E10 | N/A |
Commercial assay or kit | Mouse/rat IGF-1 Quantikine ELISA kit | R and D | R and D Systems, Inc, Minneapolis, MN | N/A |
Commercial assay or kit | Corticosterone Competitive ELISA kit | Invitrogen | Cat# EIACORT | N/A |
Commercial assay or kit | iScript cDNA synthesis kit | BIO-RAD | Cat# 170–8891 | N/A |
Commercial assay or kit | Sybr Green Master Mix | Thermo Fisher | Cat# A25778 | N/A |
Commercial assay or kit | Senescence detection kit | Abcom | Cat#: AB65351 | N/A |
Antibody | Mac2 (rat monoclonal) |
BioLegend | Cat# 125401 RRID:AB_1134237 |
IF(1:500) IHC(1:500) |
Antibody | Perilipin (goat polyclonal) |
Novus | Cat# NB100-60554 RRID:AB_922242 |
IF(1:500) |
Antibody | Insulin (guinea pig polyclonal) |
Dako | Cat# A0564 RRID:AB_10013624 |
IF(1:500) |
Antibody | Glucagon (rabbit polyclonal) |
Invitrogen | Cat# 15954–1-AP RRID:AB_2878200 |
IF(1:500) |
Antibody | Alexa Fluor 488 goat anti-guinea pig IgG (HCL) | Invitrogen | Cat# A-11073 RRID:AB_2534117 |
IF(1:250) |
Antibody | Alexa Fluor 594 donkey anti-rabbit IgG (HCL) | Invitrogen | Cat# A32754 RRID:AB_2762827 |
IF(1:250) |
Antibody | Alexa Fluor 594 donkey anti-goat IgG (HCL) | Invitrogen | Cat# A32758 RRID:AB_2762828 |
IF(1:250) |
Antibody | Alexa Fluor 488 goat anti-rat IgG (HCL) | Invitrogen | Cat# A48262 | IF(1:250) |
Antibody | CD45-PerCP/Cyanine5.5 (rat monoclonal) |
Biolegend | Cat# 103132 RRID:AB_893340 |
FACS(1:400) |
Antibody | CD11b-Pacific Blue (rat monoclonal) |
Biolegend | Cat# 101224 RRID:AB_755986 |
FACS(1:200) |
Antibody | F4/80 -PE (rat monoclonal) |
Biolegend | Cat# 123110 RRID:AB_893486 |
FACS(1:200) |
Antibody | CD11c -APC (Armenian Hamster monoclonal) |
Biolegend | Cat# 117310 RRID:AB_313779 |
FACS(1:200) |
Antibody | CD206 -FITC (rat monoclonal) |
Biolegend | Cat# 141703 RRID:AB_10900988 |
FACS(1:200) |
Sequence-based reagent | Gapdh _F | This paper | PCR primers | TGTGAACGGATTTGGCCGTA |
Sequence-based reagent | Gapdh _R | This paper | PCR primers | ACTGTGCCGTTGAATTTGCC |
Sequence-based reagent | F4/80_F | This paper | PCR primers | TGACTCACCTTGTGGTCCTAA |
Sequence-based reagent | F4/80_R | This paper | PCR primers | CTTCCCAGAATCCAGTCTTTCC |
Sequence-based reagent | IL-6_F | This paper | PCR primers | CCAGAGATACAAAGAAATGATGG |
Sequence-based reagent | IL-6_R | This paper | PCR primers | ACTCCAGAAGACCAGAGGAAAT |
Sequence-based reagent | TNFα_F | This paper | PCR primers | GAGAAAGTCAACCTCCTCTCTG |
Sequence-based reagent | TNFα_R | This paper | PCR primers | GAAGACTCCTCCCAGGTATATG |
Software, algorithm | Prism | GraphPad Software | GraphPad Software | N/A |
Software, algorithm | Illustrator | Adobe | N/A | N/A |
Other | Keyence BZ-X700 fluorescence microscope | Keyence | N/A | N/A |
Other | Zeiss Axioskop FS2 microscope | Zeiss | N/A | N/A |