Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Selected siRNA and their location with the consensus target of the N gene cds.
| Total Accession | Target | Location of the target within the gene | siRNA target sequence within the gene |
|---|---|---|---|
| 270 | Consensus (270/270) | 314−336 | GTCCAAGATGGTATTTCTACTAC |
| Consensus (270/270) | 727−749 | GGCCAAACTGTCACTAAGAAATC | |
| Consensus (269/270) | 789−811 | TGCCACTAAAGCATACAATGTAA | |
| Consensus (270/270) | 892−914 | TACAAACATTGGCCGCAAATTGC |
