Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Leishmania tarentolae) | LEXSY host P10 | Jena Biosciences | LT-101 | |
| Genetic reagent (Mus musculus) | Tpm3.1-APEX2 ± heterozygous | PMID:31331962 | ||
| Cell line (Mesocricetus auratus) | BHK-21 | ATCC | CCL-10 | |
| Cell line (Homo sapiens) | A-431 | ATCC | CRL-1555 | |
| Cell line (Cricetulus griseus) | Flp-In-CHO | Invitrogen | R75807 | |
| Transfected construct (synthetic) | LifeAct-APEX2 | This study | RRID:170523 | |
| Transfected construct (Mus musculus) | Cavin4-APEX | This study | RRID:170524 | |
| Transfected construct (synthetic) | pCSDEST2 | PMID:17948311 | RRID:22424 | |
| Transfected construct (synthetic) | p3E-APEX2 | PMID:29621251 | RRID:108894 | |
| Transfected construct (synthetic) | p3E-APEX2-P2A-mKate2 | PMID:26585296 | RRID:61671 | |
| Transfected construct (Mus musculus) | pME-CAV1 | This study | RRID:170527 | |
| Transfected construct (synthetic) | pME-LifeAct | PMID:32709891 | RRID:109545 | |
| Transfected construct (Mus musculus) | pME-Cavin4 | This study | RRID:170528 | |
| Transfected construct (Homo sapiens) | A1AR-APEX2 | This study | RRID:170529 | |
| Antibody | Anti-tropomyosinthree mouse monoclonal | Sigma-Aldrich | MABT1335 | (1:1000) |
| Antibody | Anti-alpha tubulin rabbit monoclonal | Abcam | Ab52866 | (1:3000) |
| Recombinant DNA reagent | GFP-CAV1-APEX (cell-free) | This study | RRID:170525 | |
| Recombinant DNA reagent | CAV1-APEX (cell-free) | This study | RRID:170526 | |
| Recombinant DNA reagent | pCellFree_G03 | PMID:25529348 | ||
| Recombinant DNA reagent | pCellFree_G03 | PMID:25529348 | ||
| Sequence-based reagent | Antisplice leader oligonucleotide | PMID:19648909 | CAATAAAGTACAGAAACTGATACTTATATAGCGTT | |
| Commercial assay or kit | FluoroTect GreenLys in vitro Translation Labeling System | Promega | L5001 | |
| Commercial assay or kit | MycoAlert Mycoplasma Detection Kit | Lonza | LT07-418 | |
| Chemical compound, drug | 25% EM grade glutaraldehyde | Electron Microscopy Services | 16220 | |
| Chemical compound, drug | 16% EM grade paraformaldehyde | Electron Microscopy Services | 15710 | |
| Chemical compound, drug | Uranyl acetate | Electron Microscopy Services | 22400 | |
| Chemical compound, drug | Lead citrate | ProSciTech | C073 | |
| Chemical compound, drug | DAB | Sigma-Aldrich | D5905 | |
| Chemical compound, drug | Hydrogen peroxide solution | Sigma-Aldrich | H1009 | |
| Chemical compound, drug | Osmium tetroxide | ProSciTech | C010 | |
| Chemical compound, drug | LX 112 Embedding Kit | Ladd Research Industries | 21210 | |
| Chemical compound, drug | Horseradish peroxidase – 25 mg Type VI-A | Sigma-Aldrich | P6782 | |
| Chemical compound, drug | Silver nitrate | Sigma-Aldrich | 209139 | |
| Chemical compound, drug | Gum arabic | Electron Microscopy Services | 25574 | |
| Chemical compound, drug | Gold chloride | Electron Microscopy Services | 16583 | |
| Chemical compound, drug | Hexamethylenetetramine | Sigma-Aldrich | 398160 | |
| Chemical compound, drug | Sodium tetraborate decahydrate (borax) | Sigma-Aldrich | B9876 | |
| Chemical compound, drug | Sodium thiosulphate | Sigma-Aldrich | 72049 | |
| Chemical compound, drug | Bactotryptone | Beckton Dickinson | 211699 | |
| Chemical compound, drug | Hemin chloride | MP Biomedicals | 0219402505 | |
| Chemical compound, drug | ATP | Chem-Impex | 00015 | |
| Chemical compound, drug | GTP | Chem-Impex | 00348 | |
| Chemical compound, drug | Spermidine | Sigma-Aldrich | 85558–5G | |
| Chemical compound, drug | DTT | Sigma-Aldrich | D0632-10G | |
| Chemical compound, drug | Cr phosphate | Chem-Impex | 00072 | |
| Chemical compound, drug | PEG 3350 | Hampton Research | HR2-527 | |
| Chemical compound, drug | Prot Inhib C | Roche Diagnostics | 11 873 580 001 | |
| Chemical compound, drug | CTP | Chem-Impex | 00095 | |
| Chemical compound, drug | UTP | Chem-Impex | 00311 | |
| Chemical compound, drug | T7 polymerase | In-house purification | N/A | |
| Chemical compound, drug | Cr phosphokinase | Sigma-Aldrich | C3755-35KU | |
| Chemical compound, drug | Alanine | Sigma-Aldrich | A7627 | |
| Chemical compound, drug | Arginine | Sigma-Aldrich | A5006 | |
| Chemical compound, drug | Asparagine | Sigma-Aldrich | A0884 | |
| Chemical compound, drug | Aspartic acid | Sigma-Aldrich | A9256 | |
| Chemical compound, drug | Cysteine | Sigma-Aldrich | C7352 | |
| Chemical compound, drug | Glutamic acid | Sigma-Aldrich | 49449 | |
| Chemical compound, drug | Glutamine | Sigma-Aldrich | G3126 | |
| Chemical compound, drug | Glycine | Sigma-Aldrich | G7126 | |
| Chemical compound, drug | Histidine | Sigma-Aldrich | H8000 | |
| Chemical compound, drug | Isoleucine | Sigma-Aldrich | I2752 | |
| Chemical compound, drug | Leucine | Sigma-Aldrich | L8912 | |
| Chemical compound, drug | Lysine | Sigma-Aldrich | L5626 | |
| Chemical compound, drug | Methionine | Sigma-Aldrich | M9625 | |
| Chemical compound, drug | Phenylalanine | Sigma-Aldrich | P2126 | |
| Chemical compound, drug | Proline | Sigma-Aldrich | P0380 | |
| Chemical compound, drug | Serine | Sigma-Aldrich | S4500 | |
| Chemical compound, drug | Threonine | Sigma-Aldrich | T8625 | |
| Chemical compound, drug | Tryptophan | Sigma-Aldrich | T0524 | |
| Chemical compound, drug | Tyrosine | Sigma-Aldrich | T8566 | |
| Chemical compound, drug | Valine | Sigma-Aldrich | V0500 | |
| Chemical compound, drug | Penicillin-streptomycin | Life Technologies | 15070–063 | |
| Chemical compound, drug | Potassium acetate | Sigma-Aldrich | P1190 | |
| Chemical compound, drug | Magnesium acetate | Amresco | 0131–1 KG | |
| Chemical compound, drug | LR clonase II Plus | Invitrogen | 12538120 | |
| Chemical compound, drug | Hygromycin-B | Thermo Fisher/Invitrogen | 10687010 | |
| Chemical compound, drug | DMEM | Life Technologies | 11995065 | |
| Chemical compound, drug | L-glutamine | Life Technologies | 25030081 | |
| Chemical compound, drug | Fetal bovine serum | Sigma-Aldrich | F9423 | |
| Software, algorithm | ImageJ/FIJI | PMID:22743772 | https://imagej.nih.gov/ij/ | |
| Software, algorithm | ImageJ/FIJI Weka Plugin | ImageJ developers | https://imagej.net/Trainable_Segmentation | |
| Software, algorithm | iTEM | Olympus | https://www.emsis.eu/home/ | |
| Software, algorithm | AttoBright: LabView and GUI for data acquisition, Matlab code and GUI for data analysis | PMID:31827096 | https://gambinsiereckilab.github.io/AttoBright/ | |
| Software, algorithm | MAPs | Thermo Fisher | https://www.fei.com/software/maps/#gsc.tab=0 |