Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Position | Score | P value | Site sequence |
|---|---|---|---|
| −2,543 | 0.811344 | 0.016892 | AGGGCAAGGGCTGACCA |
| −2,529 | 0.811344 | 0.016892 | TGACCACAGAAGGGCA |
| −2,284 | 0.803993 | 0.0139931 | TGCCAGCTCTGTCCAGGTCA |
PPARγ, peroxisome proliferators-activated receptors γ; SFRP5, secreted frizzled related protein 5.
