KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse moclonal anti-ORC1 | CSHL Facility | Kara et. al., 2015 |
| Rabbit polyclonal anti-CDC6 | CSHL Facility | Hossain et al., 2016 |
| Rabbit polyclonal anti-ORC3 | CSHL Facility | Siddiqui et al., 2007 |
| Goat polyclonal anti-ORC4 | Abcam | Abcam Cat# ab9641, RRID:AB_296536 |
| Mouse monoclonal anti-Cyclin A | BD Biosciences | BD Biosciences Cat# 611269, RRID:AB_398797 |
| Rabbit polyclonal anti-Skp2 | Abcam | Abcam Cat# ab19877, RRID:AB_777950 |
| Mouse monoclonal anti-CDC6 | Millipore | Millipore Cat# 05550, RRID:AB_2276118 |
| Mouse monoclonal anti-Cyclin E | BD Biosciences | BD Biosciences Cat# 551159, RRID:AB_394079 |
| Mouse monoclonal anti-Cdt1 | CSHL Facility | PKS13 |
| Rabbit monoclonal anti-SETD8 | Cell Signaling Technology | Cell Signaling Technology Cat# 2996, RRID:AB_2254384 |
| Mouse monoclonal anti-Histone H3(Ser10) | Cell Signaling Technology | Cell Signaling Technology Cat# 9706, RRID:AB_331748 |
| Mouse monoclonal anti-MBP | New England Biolabs | New England Biolabs Cat# E8032, RRID:AB_1559730 |
| Goal polyclonal anti-GST | GE Healthcare | GE Healthcare Cat# 27-4577-01, RRID:AB_771432 |
| Mouse monoclonal anti-GST | CSHL Facility | N/A |
| Rabbit polyclonal anti-Cyclin F | Santa Cruz Biotechnology | Santa Cruz Biotechnology Cat# sc-952, RRID:AB_2071212 |
| Rabbit polyclonal anti-phospho RB (Ser807/811) | Cell Signaling Technology | Cell Signaling Technology Cat# 9308, RRID:AB_331472 |
| Rabbit polyclonal anti-GFP | Sigma-Aldrich | Sigma-Aldrich Cat# G1544, RRID:AB_439690 |
| Mouse monoclonal anti-GFP | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# A-11120, RRID:AB_221568 |
| Rabbit polyclonal anti-6X His | Abcam | Abcam Cat# ab9108, RRID:AB_307016 |
| Mouse monoclonal anti-Cdh1 | Millipore | Millipore Cat# CC43, RRID:AB_2260255 |
| Rabbit polyclonal anti-Cdt2 | Novus | Novus Cat# NB100–40840, RRID:AB_789689 |
| Rabbit polyclonal anti-PPP1CA | Bethyl | Bethyl Cat# A300–904A, RRID:AB_2284190 |
| Mouse monoclonal anti-PP1 alpha | Santa Cruz Biotechnology | Santa Cruz Biotechnology Cat# sc-271762, RRID:AB_10708123 |
| Rabbit polyclonal anti-PP1 beta | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# PA5-28225, RRID:AB_2545701 |
| Rabbit polclonal anti-PPP1CC | Bethyl | Bethyl Cat# A300-906A, RRID:AB_2168105 |
| Rabbit polyclonal anti-RIF1 | Bethyl | Bethyl Cat# A300–568A, RRID:AB_669806 |
| Bacterial and Virus Strains | ||
| BL21(DE3) Competent E. coli | New England Biolab | Cat# C2527I |
| XL10 Gold Ultracompetent Cells | Stratagene | Cat# 200314 |
| 5-alpha Competent E. coli | New England Biolab | Cat# C2987I |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Lambda Protein Phosphatase | New England Biolab | Cat# P0753 |
| PreScission Protease | GE Healthcare | Cat# 27084301 |
| MG-132 | Sigma-Aldrich | Cat# 474787 |
| Cycloheximide | Sigma-Aldrich | Cat# C4859 |
| Doxycycline | Sigma-Aldrich | Cat# D9891 |
| Nocodazole | Sigma-Aldrich | Cat# M1404 |
| Hygromycin B | Thermo Fisher Scientific | Cat# 10687010 |
| Blasticidin S HCl | Thermo Fisher Scientific | Cat# A1113903 |
| Zeocin | Thermo Fisher Scientific | Cat# R25001 |
| Benzonase nuclease | Sigma-Aldrich | Cat# E1014 |
| Thymidine | Sigma-Aldrich | Cat# T1895 |
| Roscovitine | Sigma-Aldrich | Cat# 557364 |
| DMEM | Corning | Cat# 10–013-CV |
| JMEM medium | USBiological Life Sciences | Cat# M3867 |
| Fetal Bovine Serum | Sigma-Aldrich | Cat# F2442 |
| Tet System Approved FBS | Takara | Cat# 631101 |
| HyClone Calf Serum | Thermo Fisher Scientific | Cat# SH3008704 |
| Dynabeads ProteinG | Thermo Fisher Scientific | Cat# 10004D |
| Phusion high fidelity DNA polymerase | New England Biolab | Cat# M0530 |
| T7 gene 6 exonuclease | Thermo Fisher Scientific | Cat# 70025Z10KU |
| Amylose resin | New England Biolab | Cat# E8021 |
| Glutathione agarose | Thermo Fisher Scientific | Cat# 16100 |
| Ni-NTA resin | Qiagen | Cat# 30210 |
| Hemagglutinin peptide | Millipore Sigma | Cat# I2149 |
| Anti-HA Agarose | Thermo Fisher Scientific | Cat# 26181 |
| HRV-3C Protease, Biotin tagged | Millipore Sigma | Cat# SAE0110 |
| Critical Commercial Assays | ||
| Click-iT® Plus EdU Alexa Fluor® 647 Flow Cytometry Assay Kit | Thermo Fisher Scientific | Cat# C10635 |
| Experimental Models: Cell Lines | ||
| Human: U2OS | ATCC | Cat# HTB-96 |
| Human: HeLa | ATCC | Cat# CCL-2 |
| Human: HEK293T | ATCC | Cat# CRL-3216 |
| Human: U2OS TReX | Malecki et. al., 2006 | N/A |
| Deposited Data | ||
| Original Images | This Study | http://dx.doi.org/10.17632/p8cn8srfvh.1 |
| Oligonucleotides | ||
| siRNA targeting sequence: Control siRNA (GL3) # CUUACGCUGAGUACUUCGA |
Dharmacon | N/A |
| siRNA targeting sequence: Cdh1 siRNA# AAUGAGAAGUCUCCCAGUCAG |
Dharmacon | N/A |
| siRNA targeting sequence: Cdt2 siRNA# GAAUUAUACUGCUUAUCGA |
Dharmacon | N/A |
| siRNA targeting sequence: Cyclin F siRNA# UAGCCUACCUCUACAAUGA |
Dharmacon | N/A |
| siRNA targeting sequence: Skp2 siRNA# GAGACCAUCACCCAGCUGAAU |
Dharmacon | N/A |
| siRNA targeting sequence: PP1α siRNA# GAGACGCUACAACAUCAAA |
Dharmacon | N/A |
| siRNA targeting sequence: PP1β siRNA# AGAAGUUCGAGGCUUAUGU |
Dharmacon | N/A |
| siRNA targeting sequence: PP1γ siRNA# CUAUCCUACUAGAACUUGA |
Dharmacon | N/A |
| siRNA targeting sequence: RIF1 siRNA# AGAAUGAGCCCCUAGGGAA |
Dharmacon | N/A |
| siRNA targeting sequence: Orc1 UTR siRNA# GGAAAUGGCUCUCAUGUAU |
Dharmacon | N/A |
| Forward 5’[Biotin]- GAAGCTAGACTTAGGTGTCATATTGAACCTACTATGCCGAACTAGTTACGAGCTATAAAC-3’ |
SIGMA | N/A |
| Forward 5’[Cy5]- GAAGCTAGACTTAGGTGTCATATTGAACCTACTATGCCGAACTAGTTACGAGCTATAAAC-3’ |
SIGMA | N/A |
| Reverse 5’- GTTTATAGCTCGTAACTAGTTCGGCATAGTAGGTTCAATATGACACCTAAGTCTAGCTTC-3’ |
SIGMA | N/A |
| Recombinant DNA | ||
| pcDNAFRT5 | Thermo Fisher Scientific | Cat# V601020 |
| pOG44 | Thermo Fisher Scientific | Cat# V600520 |
| pMAL-c2E | Addgene | Cat# 75291 |
| pGEX-6P-1 | Sigma-Aldrich | Cat# GE28-9546-48 |
| pEGFP-C1 | BD Biosciences | Cat# 6084–1 |
| pECFP(C1)-PP1alpha | Addgene | Cat# 44233 |
| pEGFP(N3)-PP1beta | Addgene | Cat# 44223 |
| pEGFP(C1)-PP1gamma | Addgene | Cat# 44225 |
| mCherry2-C1 | Addgene | Cat# 54563 |
| mEGFP-C1 | Addgene | Cat# 54759 |
| Software and Algorithms | ||
| FlowJo Software | FlowJo, LLC | https://www.flowjo.com/ |
| ImageJ | NIH | https://imagej.nih.gov/ij/ |