KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-Caspase-1 (p20, mouse) | AdipoGen Life Sciences | Cat# AG-20B-0042; RRID:AB_2490248 |
| Rabbit monoclonal anti-GSDMD (mouse) | Abcam | Cat# ab209845; RRID:AB_2783550 |
| Goat polyclonal anti-IL-1β (mouse) | R&D Systems | Cat# AF-401-NA; RRID:AB_416684 |
| Rabbit polyclonal anti-GSDMD (human) | Atlas Antibodies | Cat# HPA044487; RRID:AB_2678957 |
| Goat polyclonal anti-IL-1β (human) | R&D Systems | Cat# AF-201-NA; RRID:AB_354387 |
| Rabbit monoclonal anti-GSDME | Abcam | Cat# ab215191; RRID:AB_2737000 |
| Rabbit recombinant anti-Caspase-1 (p10 + p12) | Abcam | Cat# ab179515; RRID:AB_2884954 |
| Rabbit polyclonal anti-Caspase-3 | Cell Signaling Technology | Cat# 9662; RRID:AB_331439 |
| Rabbit monoclonal anti-Caspase-8 | Cell Signaling Technology | Cat# 4790; RRID:AB_10545768 |
| Rabbit polyclonal anti-Caspase-8 (cleaved) | Cell Signaling Technology | Cat# 9429; RRID:AB_2068300 |
| Mouse monoclonal anti-Caspase-9 | Cell Signaling Technology | Cat# 9508; RRID:AB_2068620 |
| Monoclonal anti-goat IgG-HRP | Santa Cruz Biotechnology | Cat# sc-2354; RRID:AB_628490 |
| Polyclonal anti-mouse IgG-HRP | Cell Signaling Technology | Cat# 7076; RRID:AB_330924 |
| Polyclonal anti-rabbit IgG-HRP | Cell Signaling Technology | Cat# 7074; RRID:AB_2099233 |
| Bacterial and virus strains | ||
| Salmonella enterica subsp. enterica serovar Typhimurium | American Type Culture Collection | Cat# 14028 |
| Chemicals, peptides, and recombinant proteins | ||
| Propidium iodide | ThermoFisher Scientific | Cat# P1304MP |
| Nigericin | MilliporeSigma | Cat# N7143 |
| Val-boroPro/Talabostat | R&D Systems | Cat# 3719 |
| Live cell imaging solution | ThermoFisher Scientific | Cat# A14291DJ |
| SuperCalf serum | GeminiBio | Cat# 100-510 |
| Fetal bovine serum | GeminiBio | Cat# 100-106 |
| Salmonella minnesota ultrapure lipopolysaccharide | InvivoGen | Cat# tlrl-smlps |
| Critical commercial assays | ||
| CyQUANT LDH Cytotoxicity Assay | ThermoFisher Scientific | Cat# C20301 |
| Human IL-1β ELISA MAX Deluxe Kit | BioLegend | Cat# 437004 |
| Experimental models: Cell lines | ||
| THP-1 human monocytic leukemia | American Type Culture Collection | Cat# TIB-202, RRID:CVCL_0006 |
| Immortalized murine bone marrow-derived macrophages overexpressing FLAG-NLRP3 and mCerulean-ASC (iBMMs) | Eicke Latz (De Nardo et al., 2018) | N/A |
| iBMM Gsdmd−/− | Rathkey et al., 2018 | N/A |
| Oligonucleotides | ||
| Human GSDMD crRNA targeting 11CCT(−): TCTCCGGACTACCCGCTCAA | This paper | N/A |
| Human GSDME crRNA targeting 653CCT(−): GTATAACTCAATGACACCGT | This paper | N/A |
| Human GSDME crRNA targeting 170CCC(−): TTCTATGAGTACATCGCCAA | This paper | N/A |
| Recombinant DNA | ||
| pLN.GSDME (third generation lentiviral vector based on pLentiCRISPR v2): EF-1α–PuroR–P2A–GSDME-WPRE | This paper | N/A |
| pLN.GSDMED270A | This paper | N/A |