Extended Data Fig. 1 |. Generation and characterization of H1cTKO;Vav-iCre mice.

a, Unsupervised clustering of 23 primary mouse tissues by H1 subtype protein content and percent H1c/H1d/H1e as determined by quantitative RP-HPLC of histone proteins isolated from each tissue. b, Schematic of the conditional Hist1h1d knockout in an Hist1h1c/Hist1h1e double knockout background (left). Genotyping primers are indicated. P1: 5′AAGTAGAGTGGTGCGTCCTGCTTTG P2: 5′ GCCAGAAGTCCAGCTAGAGCTGAAA. Representative genotyping results using primers which expand give a 239-bp amplicon in WT mice and a 340-bp amplicon when the Hist1h1d locus is flanked by loxP sites (right). All mice used in this study were genotyped in this manner. c, Hist1h1d conditional deletion efficiency was measured in genomic DNA isolated from peripheral blood of WT, H1cTKO and H1cTKO;Vav-iCre mice (n = 2) using primers targeting the Hist1h1d locus. d, H1 subtype mRNA transcripts in WT, H1cTKO and H1cTKO;Vav-iCre mice (n = 2) were measured by RT-qPCR and normalized to Gapdh mRNA using the ΔΔC_t method. e–g, Acid extracted histones from (e) thymus (n = 2), (f) spleen (n = 4) and (g) bone marrow (n = 4) of WT and H1cTKO;Vav-iCre mice were analysed by quantitative HPLC and the relative abundance of each H1 subtype to H2B determined by dividing the area under the H1 A₂₁₄ peak by one-half of the area under the H2B A₂₁₄ peak. Total H1:nucleosome ratio was determined by summation of the areas under each H1 subtype peak relative to one-half the area under the H2B peak. Absorbance values of the H1 and H2B peaks were normalized to peptide bond number. h, The total number of WBCs in peripheral blood obtained from the facial vein of WT (n = 4), H1cTKO (n = 4) and H1cTKO;Vav-iCre (n = 4) was measured by automated CBC (Oxford Scientific). i, Flow cytometry strategy for separating B cells, and CD4⁺ and CD8⁺ T cells from spleens (shown) and other tissues. Corresponds to Fig. 1b, Extended Data Fig. 2e. j, Flow cytometry strategy for identifying immature and mature T cell populations in thymus. Corresponds to Fig. 1c. Data are mean ± s.d. nd, not detected; ns, not statistically significant; *P ≤ 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001, unpaired t-test.