Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Danio rerio) | Kcnk5b | genebank | ZFIN:ZDB-GENE-040426–1297 | |
| Gene (Danio rerio) | Kcnk9 | genebank | ZFIN:ZDB-GENE-070705–260 | |
| Gene (Danio rerio) | Kcnk10a | genebank | ZFIN:ZDB-GENE-041210–291 | |
| Gene (Homo sapiens) | CaN | genebank | HGNC:HGNC:9314 | |
| Gene (Danio rerio) | lef1 | genebank | ZFIN:ZDB-GENE-990714–26 | |
| Gene (Danio rerio) | shha | genebank | ZFIN:ZDB-GENE-980526–166 | |
| Gene (Danio rerio) | aldh1a2 | genebank | ZFIN:ZDB-GENE-011010–3 | |
| Gene (Danio rerio) | pea3 | genebank | ZFIN:ZDB-GENE-990415–71 | |
| Gene (Danio rerio) | msxb | genebank | ZFIN:ZDB-GENE-980526–312 | |
| Gene (Danio rerio) | ptch1 | genebank | ZFIN:ZDB-GENE-980526–196 | |
| Gene (Danio rerio) | ptch2 | genebank | ZFIN:ZDB-GENE-980526–44 | |
| Gene (Danio rerio) | bmp2b | genebank | ZFIN:ZDB-GENE-980526–474 | |
| Gene (Danio rerio) | axin2 | genebank | ZFIN:ZDB-GENE-000403–2 | |
| Gene (Danio rerio) | bactin2 | genebank | ZFIN:ZDB-GENE-000329–3 | |
| Gene (Homo sapiens) | lef1 | genebank | HGNC:HGNC:6551 | |
| Gene (Homo sapiens) | shh | genebank | HGNC:HGNC:10848 | |
| Gene (Homo sapiens) | aldh1a12 | genebank | HGNC:HGNC:15472 | |
| Gene (Homo sapiens) | pea3 | genebank | HGNC:HGNC:3493 | |
| Gene (Homo sapiens) | msxb | genebank | HGNC:HGNC:7391 | |
| Gene (Homo sapiens) | GAPDH | genebank | HGNC:HGNC:4141 | |
| Strain, strain background (AB as background, both male and female) | Tg[hsp70:Kcnk5b-GFP] | AB fish from CZRC | AB fish Catlog ID: CZ1 | Based on tol2 transposable element |
| Strain, strain background (AB as background,both male and female) | Tg[hsp70:Kcnk5bS345A-GFP] | AB fish from CZRC | AB fish Catlog ID: CZ1 | Based on tol2 transposable element |
| Strain, strain background (AB as background,both male and female) | Tg[hsp70:Kcnk5bS345E-GFP] | AB fish from CZRC | AB fish Catlog ID: CZ1 | Based on tol2 transposable element |
| Strain, strain background (AB as background,both male and female) | Tg[hsp70:Kcnk9-GFP] | AB fish from CZRC | AB fish Catlog ID: CZ1 | Based on tol2 transposable element |
| Strain, strain background (AB as background,both male and female) | Tg[7XTCF-Xla.sam:mCherry] | European Zebrafish Resource Center | Cat.#:15200 | |
| Genetic reagent (Oryzias latipes) | Transposase RNA |
This paper | This paper | In vitro transcripted by sp6 kit |
| Genetic reagent | DIG RNA Labeling Mix | Roche | Cat.#:1277073 | |
| Genetic reagent (E. coli) |
T7 RNA-polymerase | Promega | Cat. #:P207B | |
| Cell line (human) | pLenti-CMV-Kcnk5b-EGFP | OBiO | Contract number:HYKY-181108018-DLV | Titer:1.67E*08 TU/ml |
| Cell line (human) | pLenti-CMV- EGFP | OBiO | Contract number:HYKY-181108018-DLV | Titer:1.55E*09 TU/ml |
| Transfected construct (human) | CMV-Kcnk5b-GFP | This paper | Primers from https://www.genewiz.com.cn | Kcnk5b is cloned from adult zebrafish fin cDNA library |
| Transfected construct (human) | CMV-Kcnk9-GFP | This paper | Primers from https://www.genewiz.com.cn | Kcnk9 is cloned from zebrafish 3dpf larva cDNA library |
| Transfected construct (human) | CMV-Kcnk10-GFP | This paper | Primers from https://www.genewiz.com.cn | Kcnk10 is cloned from zebrafish 3dpf larva cDNA library |
| Transfected construct (human) | CMV-CaN-Mcherry | This paper | Primers from https://www.genewiz.com.cn | CaN is cloned from adult zebrafish fin cDNA library |
| Transfected construct (human) | CMV-Kirin | Shen et al., 2019 | ||
| Biological sample (zebrafish) | Adult zebrafish fin tissue | This paper | This paper | Freshly isolated after heatshock at indicated time points |
| Antibody | Anti-GFP (mouse monoclonal) | Invitrogen | Cat. #: MA5-15349 RRID:AB_987186 |
IF(1: 400) |
| Antibody | Anti-β-catenin (rabbit polyclonal) | Cell Signaling | Cat. #: 9562L RRID: B_331149 |
WB(1:1000) IF(1:400) |
| Antibody | Anti-Lef1(rabbit monoclonal) | Cell Signaling | Cat. #:2230T RRID:AB_823558 |
WB (1:1000) |
| Antibody | Anti-Shh(rabbit polyclonal) | Novus | Cat. #: NBP2-22139 |
WB (1:1000) |
| Antibody | Anti-mCherry antibody(rabbit polyclonal) | Invitrogen | Cat.#:PA534974 RRID: AB_2552323 |
IF(1:1000) |
| Antibody | Anti-mouse-GFP (goat polyclonal) | Abcam | Cat.#:ab150113 RRID:AB_2576208 |
IF(1:1000) |
| Antibody | Goat-anti-rabbit-mCherry secondary antibody(Goat polyclonal) | Abcam | Cat.#:ab150078 RRID:AB_2722519 |
IF(1:2000) |
| Antibody | Anti-Mouse IgG (goat Polyclonal) |
Sigma | Cat. #:A3682-1ML RRID:AB_258100 |
WB(1:80000) |
| Antibody | Anti-Rabbit IgG (H+L) (donkey Polyclonal) |
Jackson | Cat. #:711-036-152 RRID:AB_2340590 |
WB(1:20000) |
| Antibody | Anti-β-Actin pAb-HRP-DirecT (rabbit Polyclonal) | MBL | Cat. #:PM053-7 RRID:AB_10697035 |
WB(1:2000) |
| Antibody | Anti-Digoxigenin-AP, Fab fragments(sheep polyclonal) | Roche | Cat.#:11093274910 | Insitu(1:5000) |
| Recombinant DNA reagent | NovoRec plus One step PCR Cloning Kit | novoprotein | Cat. #:NR005-01B | |
| Sequence-based reagent | F-kcnk9 | This paper | Pcr primers | ATGAAGAGGCAGAACGTGCGGACGC |
| Sequence-based reagent | R-kcnk9 | This paper | Pcr primers | GATGGACTTGCGTCGTCTCATAAGCCGG |
| Sequence-based reagent | F-kcnk10 | This paper | Pcr primers | ATGAAATTTCCAACGGAAAACCCGAGGAAG |
| Sequence-based reagent | R-kcnk10 | This paper | Pcr primers | CTATGGATCCACCTGCAAACGGAACTC |
| Commercial assay or kit | Protein Quantitative Kit (BCA) | MDBio | Cat. #:KT054-200rxn | |
| Chemical compound, drug | FK506 | Sigma | Cat. #:F4679-5MG | |
| Chemical compound, drug | DL-Dithiothreitol | Promega | Cat. #:P117B | |
| Chemical compound, drug | Adenosine 5’-triphosphate disodium salt hydrate | sigma | Cat. #:A2383 | |
| Chemical compound, drug | Nitro Blue Tetrazolium | Sigma | Cat. #:N6639 | |
| Chemical compound, drug | BCIP | Sigma | Cat. #:B-8503 | |
| Chemical compound, drug | DAPI | Roche | Cat.#:10236276001 | |
| Software, algorithm | ImageJ | Open source | RRID:SCR_003070 | https://imagej.nih.gov/ij/ |
| Software, algorithm | SymPhoTime 64 | PicoQuant | RRID:SCR_016263 | Used to analysis flim data |
| Software, algorithm | Zen Blue | Zeiss | RRID:SCR_013672 | |
| Software, algorithm | Patchmaster | Heka | RRID:SCR_000034 | |
| Software, algorithm | Graphpad prism | Graphpad Software |
RRID:SCR_002798 | |
| Software, algorithm | Clampfit10.5 | Axon |
RRID:SCR_011323 | |
| Other | ExpressPlus PAGE Gel, 8–16%, 15 wells | Genscript | Cat.#:M81615C | For western blotting |
| Other | Western Lightning Plus ECL 680 | PerkinElmer(PE) | Cat.#:NEL105001EA | For western blotting |
| Other | MMESSAGE MMACHINE SP6 KIT | Invitrogen | Cat.#:AM1340 |