Table 1.
List of used primers and their sequences
| Sr # | Genes markers | PCR product (bp) | PCR primer set (5’-3’) |
|---|---|---|---|
| 1 | Beta actin | 137 | Forward primer: CGCATGGGTCAGAAGGATTC |
| Reverse primers: TAGAAGGTGTGGTGCCAGATTT | |||
| 2 | OCN | 229 | Forward primer: CTCACACTCCTCGCCCTATT |
| Reverse primer: CCTCCTGCTTGGACACAAA | |||
| 3 | RUNX | 250 | Forward primer: ACCTTGACCATAACCGTCTTCAC |
| Reverse primer: TCCCGAGGTCCATCTACTGTAAC |
The following PCR conditions were used; denaturation for 5 minutes at 95°C; followed by annealing for 30 seconds at 55°C and extension at 72°C. PCR products were visualized by agarose gel electrophoresis.