REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit anti-SLF2	Abcam	Cat#ab122480; RRID: AB_11129755
Rabbit anti-VPRBP/DCAF1	Abcam	Cat#ab202587; RRID: RRID: AB_2885060
Rabbit anti-Histone H3	Abcam	Cat#ab1791; RRID: AB_302613
Rabbit anti-Histone H3K9me3	Abcam	Cat#ab8898; RRID: AB_306848
Rabbit anti-HLTF	Bethyl Laboratories	Cat#A300-230A; RRID: AB_2117307
Mouse anti-CD4-APC	Biolegend	Cat#317416; RRID: AB_571945
Mouse anti-LNGFR-PE	Biolegend	Cat#345106; RRID: AB_2152647
Rabbit anti-Histone H3K4me3	Cell Signaling	Cat#9751; RRID: AB_2616028
Rabbit anti-Histone H3K9ac	Cell Signaling	Cat#9649; RRID: AB_823528
Rabbit anti-Histone H3K27me3	Cell Signaling	Cat#9733; RRID: AB_2616029
Rabbit anti-SMC6	GeneTex	Cat#GTX116832; RRID: AB_10630494
Rabbit anti-NSMCE1	GeneTex	Cat#GTX107136; RRID: AB_1951030
Mouse anti-Vif	NIH AIDS Reagent Program	Cat#6459; (Simon et al., 1995)
Mouse anti-UNG2	Origene	Cat#TA503563; RRID: AB_11126624
Rat anti-HA	Roche	Cat#11867423001; RRID: AB_390918
Goat anti-lamin B1	Santa Cruz	Cat#sc-6217; RRID: AB_648158
Mouse anti-β-actin	Sigma-Aldrich	Cat#A5316; RRID: AB_476743
Rabbit anti-ANKRD32/SLF1	Sigma-Aldrich	Cat#SAB2701555; RRID: AB_2885061
Goat anti-mouse HRP	Jackson ImmunoResearch	Cat#115-035-146; RRID: AB_2307392
Goat anti-rabbit HRP	Jackson ImmunoResearch	Cat#111-035-144; RRID: AB_2307391
Goat anti-rat HRP	Jackson ImmunoResearch	Cat#112-035-143; RRID: AB_2338138
Bacterial and Virus Strains
pLTR-Tat-IRES-GFP	Eric Verdin	pEV731
pHRSIN.pSFFV-GFP	This paper	N/A
pHRSIN.pSFFV-mCherry	This paper	N/A
pHRSIN.pSFFV-iRFP	This paper	N/A
pNL4-3-ΔEnv-Nef-P2A-SBP- ΔLNGFR (NL4-3LNGFR)	(Naamati et al., 2019	N/A
pNL4-3-ΔEnv-Nef-P2A-SBP- ΔLNGFR-ΔVpr (ΔVpr NL4-3LNGFR)	(Naamati et al., 2019)	N/A
pNL4-3-ΔEnv-eGFP (NL4-3GFP)	NIH AIDS Reagent Program, Drs Haili Zhang, Yan Zhou, and Robert Siliciano (Zhang et al., 2004)	Cat#11100
pNL4-3-ΔEnv-eGFP-ΔVpr (ΔVpr NL4-3GFP)	(Greenwood et al., 2019)	N/A
Chemicals, Peptides, and Recombinant Proteins
Raltegravir	Cayman Chemical	Cat#16071
MLN4924	Millipore	Cat#5054770001
IL-2	PeproTech	Cat#200–02
7-AAD	Stratech	Cat#17501
Protein G magnetic beads	Pierce	Cat#88848
Anti-HA magnetic beads	Pierce	Cat#88837
SYBR Green PCR master mix	Applied Biosystems	Cat#4309155
AMPure XP	Beckman Coulter	Cat#A63881
Critical Commercial Assays
RNAscope ISH reagent kit	ACD
Dynabeads Untouched Human CD4 T Cells kit	Invitrogen	Cat#11346D
Dynabeads Human T-Activator CD3/CD28	Gibco	Cat#11132D
Dynabeads Biotin Binder	Invitrogen	Cat#11047
TDE1 Tagment DNA Enzyme	Illumina	Cat#20034197
Deposited Data
CRISPR-Cas9 KO screen data	This paper	GEO: GSE156630
ATAC-seq data	This paper	GEO: GSE156630
Experimental Models: Cell Lines
CEM-T4	NIH AIDS Reagent Program, Dr JP Jacobs (Foley et al., 1965)	Cat. #117
Jurkat T cells	ATCC	Clone E6-1, TIB-152
HEK293	Lehner Lab stock	RRID: CVCL_0063
Oligonucleotides
iRFP ChIP, forward primer: 5’- CTTCGATCGGGTGATGATCT	This paper, Sigma-Aldrich	N/A
iRFP ChIP, reverse primer: 5’- GCAGGCCTAGTTTTGACTCG	This paper, Sigma-Aldrich	N/A
Recombinant DNA
Vpr target sgRNA library, see sgRNA sequences in Table S1	This paper	N/A
pKLV-U6-sgRNA.pGK-Puro-2A-BFP; see sgRNA sequences in Table S2	This paper	N/A
pCMV.SPORT6-mCherry	This paper	N/A
pCMV.SPORT6-Vpr	This paper	N/A
pCMV.SPORT6-Vpr(Q65R)	This paper	N/A
pCMV.SPORT6-Vpr(H71R)	This paper	N/A
pHR-SIREN-shControl.pGK-HygroR (GTTATAGGCTCGCAAAAGG)	(Greenwood et al., 2019)	N/A
pHR-SIREN-shDCAF1.pGK-HygroR (GTTATAGGCTCGCAAAAGG)	(Greenwood et al., 2019)	N/A
pHRSIN.pSFFV-SLF2.pGK-PuroR	This paper	N/A
pHRSIN.pSFFV-SLF2(590-1173).pGK-PuroR	This paper	N/A
pHRSIN.pRSV-3xHA-Vpr.pUb-Emerald	(Greenwood et al., 2019)	N/A
pHRSIN.pRSV-HA-Vpr(NL4-3).pUb-Emerald	(Greenwood et al., 2019)	N/A
pHRSIN.pRSV-HA-Vpr(SIVcpzPtt).pUb-Emerald	(Greenwood et al., 2019)	N/A
pHRSIN.pRSV-HA-Vpr(rcm).pUb-Emerald	(Greenwood et al., 2019)	N/A
pHRSIN.pRSV-HA-Vpr(agm).pUb-Emerald	(Greenwood et al., 2019)	N/A
pHRSIN.pRSV-HA-Vpr(mus).pUb-Emerald	(Greenwood et al., 2019)	N/A
pHRSIN.pRSV-HA-Vpr(smm).pUb-Emerald	(Greenwood et al., 2019)	N/A
pHRSIN.pRSV-HA-Vpr(HIV-2 7312a).pUb-Emerald	(Greenwood et al., 2019)	N/A
pHRSIN.pSFFV-3xHA-HBx.pGK-PuroR	This paper	N/A
pHRSIN.pSFFV-3xHA-NSMCE2.pGK-PuroR	This paper	N/A
Software and Algorithms
FlowJo 10.7.1	FlowJo, LLC	RRID: SCR_008520
Prism 8.4.2	Graphpad	RRID: SCR_002798
Gen5	Biotek	RRID: SCR_017317
Bowtie2	(Langmead and Salzberg, 2012)	RRID: SCR_005476
FastX Toolkit	Hannon laboratory	RRID: SCR_005534
MAGeCK	(Li et al., 2014)	https://bitbucket.org/liulab/mageck/src/master/
Proteome Discoverer 2.1	Thermo Scientific	RRID: SCR_014477
FastQC	Babraham Bioinformatics, 2010	https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
cutadapt	(Martin, 2011)	RRID: SCR_011841
BWA-MEM	(Li and Durbin, 2009)	RRID: SCR_010910
sambamba	(Tarasov et al., 2015)	https://academic.oup.com/bioinformatics/article/31/12/2032/214758
SAMtools	(Li et al., 2009)	RRID: SCR_002105
BEDTools	(Quinlan and Hall, 2010)	RRID: SCR_006646
ggplot2	(Wickham, 2016)	RRID: SCR_014601
ATACseqQC	(Ou et al., 2018)	DOI:10.18129/B9.bioc.ATACseqQC
IGV 2.8.0	(Thorvaldsdóttir et al., 2013)	RRID: SCR_011793
Detailed data analysis algorithms deposited on:	This paper	https://github.com/LDUP92/hiv-compaction