Skip to main content
. 2021 May 12;29(5):792–805.e6. doi: 10.1016/j.chom.2021.03.001
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Rabbit anti-SLF2 Abcam Cat#ab122480; RRID: AB_11129755
Rabbit anti-VPRBP/DCAF1 Abcam Cat#ab202587; RRID: RRID: AB_2885060
Rabbit anti-Histone H3 Abcam Cat#ab1791; RRID: AB_302613
Rabbit anti-Histone H3K9me3 Abcam Cat#ab8898; RRID: AB_306848
Rabbit anti-HLTF Bethyl Laboratories Cat#A300-230A; RRID: AB_2117307
Mouse anti-CD4-APC Biolegend Cat#317416; RRID: AB_571945
Mouse anti-LNGFR-PE Biolegend Cat#345106; RRID: AB_2152647
Rabbit anti-Histone H3K4me3 Cell Signaling Cat#9751; RRID: AB_2616028
Rabbit anti-Histone H3K9ac Cell Signaling Cat#9649; RRID: AB_823528
Rabbit anti-Histone H3K27me3 Cell Signaling Cat#9733; RRID: AB_2616029
Rabbit anti-SMC6 GeneTex Cat#GTX116832; RRID: AB_10630494
Rabbit anti-NSMCE1 GeneTex Cat#GTX107136; RRID: AB_1951030
Mouse anti-Vif NIH AIDS Reagent Program Cat#6459; (Simon et al., 1995)
Mouse anti-UNG2 Origene Cat#TA503563; RRID: AB_11126624
Rat anti-HA Roche Cat#11867423001; RRID: AB_390918
Goat anti-lamin B1 Santa Cruz Cat#sc-6217; RRID: AB_648158
Mouse anti-β-actin Sigma-Aldrich Cat#A5316; RRID: AB_476743
Rabbit anti-ANKRD32/SLF1 Sigma-Aldrich Cat#SAB2701555; RRID: AB_2885061
Goat anti-mouse HRP Jackson ImmunoResearch Cat#115-035-146; RRID: AB_2307392
Goat anti-rabbit HRP Jackson ImmunoResearch Cat#111-035-144; RRID: AB_2307391
Goat anti-rat HRP Jackson ImmunoResearch Cat#112-035-143; RRID: AB_2338138

Bacterial and Virus Strains

pLTR-Tat-IRES-GFP Eric Verdin pEV731
pHRSIN.pSFFV-GFP This paper N/A
pHRSIN.pSFFV-mCherry This paper N/A
pHRSIN.pSFFV-iRFP This paper N/A
pNL4-3-ΔEnv-Nef-P2A-SBP- ΔLNGFR (NL4-3LNGFR) (Naamati et al., 2019 N/A
pNL4-3-ΔEnv-Nef-P2A-SBP- ΔLNGFR-ΔVpr (ΔVpr NL4-3LNGFR) (Naamati et al., 2019) N/A
pNL4-3-ΔEnv-eGFP (NL4-3GFP) NIH AIDS Reagent Program, Drs Haili Zhang, Yan Zhou, and Robert Siliciano (Zhang et al., 2004) Cat#11100
pNL4-3-ΔEnv-eGFP-ΔVpr (ΔVpr NL4-3GFP) (Greenwood et al., 2019) N/A

Chemicals, Peptides, and Recombinant Proteins

Raltegravir Cayman Chemical Cat#16071
MLN4924 Millipore Cat#5054770001
IL-2 PeproTech Cat#200–02
7-AAD Stratech Cat#17501
Protein G magnetic beads Pierce Cat#88848
Anti-HA magnetic beads Pierce Cat#88837
SYBR Green PCR master mix Applied Biosystems Cat#4309155
AMPure XP Beckman Coulter Cat#A63881

Critical Commercial Assays

RNAscope ISH reagent kit ACD
Dynabeads Untouched Human CD4 T Cells kit Invitrogen Cat#11346D
Dynabeads Human T-Activator CD3/CD28 Gibco Cat#11132D
Dynabeads Biotin Binder Invitrogen Cat#11047
TDE1 Tagment DNA Enzyme Illumina Cat#20034197

Deposited Data

CRISPR-Cas9 KO screen data This paper GEO: GSE156630
ATAC-seq data This paper GEO: GSE156630

Experimental Models: Cell Lines

CEM-T4 NIH AIDS Reagent Program, Dr JP Jacobs (Foley et al., 1965) Cat. #117
Jurkat T cells ATCC Clone E6-1, TIB-152
HEK293 Lehner Lab stock RRID: CVCL_0063
Oligonucleotides
iRFP ChIP, forward primer: 5’- CTTCGATCGGGTGATGATCT This paper, Sigma-Aldrich N/A
iRFP ChIP, reverse primer: 5’- GCAGGCCTAGTTTTGACTCG This paper, Sigma-Aldrich N/A

Recombinant DNA

Vpr target sgRNA library, see sgRNA sequences in Table S1 This paper N/A
pKLV-U6-sgRNA.pGK-Puro-2A-BFP; see sgRNA sequences in Table S2 This paper N/A
pCMV.SPORT6-mCherry This paper N/A
pCMV.SPORT6-Vpr This paper N/A
pCMV.SPORT6-Vpr(Q65R) This paper N/A
pCMV.SPORT6-Vpr(H71R) This paper N/A
pHR-SIREN-shControl.pGK-HygroR (GTTATAGGCTCGCAAAAGG) (Greenwood et al., 2019) N/A
pHR-SIREN-shDCAF1.pGK-HygroR (GTTATAGGCTCGCAAAAGG) (Greenwood et al., 2019) N/A
pHRSIN.pSFFV-SLF2.pGK-PuroR This paper N/A
pHRSIN.pSFFV-SLF2(590-1173).pGK-PuroR This paper N/A
pHRSIN.pRSV-3xHA-Vpr.pUb-Emerald (Greenwood et al., 2019) N/A
pHRSIN.pRSV-HA-Vpr(NL4-3).pUb-Emerald (Greenwood et al., 2019) N/A
pHRSIN.pRSV-HA-Vpr(SIVcpzPtt).pUb-Emerald (Greenwood et al., 2019) N/A
pHRSIN.pRSV-HA-Vpr(rcm).pUb-Emerald (Greenwood et al., 2019) N/A
pHRSIN.pRSV-HA-Vpr(agm).pUb-Emerald (Greenwood et al., 2019) N/A
pHRSIN.pRSV-HA-Vpr(mus).pUb-Emerald (Greenwood et al., 2019) N/A
pHRSIN.pRSV-HA-Vpr(smm).pUb-Emerald (Greenwood et al., 2019) N/A
pHRSIN.pRSV-HA-Vpr(HIV-2 7312a).pUb-Emerald (Greenwood et al., 2019) N/A
pHRSIN.pSFFV-3xHA-HBx.pGK-PuroR This paper N/A
pHRSIN.pSFFV-3xHA-NSMCE2.pGK-PuroR This paper N/A

Software and Algorithms

FlowJo 10.7.1 FlowJo, LLC RRID: SCR_008520
Prism 8.4.2 Graphpad RRID: SCR_002798
Gen5 Biotek RRID: SCR_017317
Bowtie2 (Langmead and Salzberg, 2012) RRID: SCR_005476
FastX Toolkit Hannon laboratory RRID: SCR_005534
MAGeCK (Li et al., 2014) https://bitbucket.org/liulab/mageck/src/master/
Proteome Discoverer 2.1 Thermo Scientific RRID: SCR_014477
FastQC Babraham Bioinformatics, 2010 https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
cutadapt (Martin, 2011) RRID: SCR_011841
BWA-MEM (Li and Durbin, 2009) RRID: SCR_010910
sambamba (Tarasov et al., 2015) https://academic.oup.com/bioinformatics/article/31/12/2032/214758
SAMtools (Li et al., 2009) RRID: SCR_002105
BEDTools (Quinlan and Hall, 2010) RRID: SCR_006646
ggplot2 (Wickham, 2016) RRID: SCR_014601
ATACseqQC (Ou et al., 2018) DOI:10.18129/B9.bioc.ATACseqQC
IGV 2.8.0 (Thorvaldsdóttir et al., 2013) RRID: SCR_011793
Detailed data analysis algorithms deposited on: This paper https://github.com/LDUP92/hiv-compaction