REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Rabbit Anti-ATG13 Monoclonal Antibody | Cell Signaling | Cat#13468; RRID: AB_2797419 |
Rabbit Anti-ATG16L1 Monoclonal Antibody | Cell Signaling | Cat#8089; RRID: AB_10950320 |
Anti-GAPDH Antibody | Abcam | Cat#ab9484; ab9484, RRID: AB_307274 |
Mouse Anti-GFP Monoclonal Antibody | Sigma | Cat#11814460001; RRID: AB_390913 |
Anti-M2 Antibody | Abcam | Cat#ab5416; RRID: AB_304873 |
Goat Anti-Rabbit IgG HRP Conjugated Antibody | Cell Signaling | Cat#7074; RRID: AB_2099233 |
Goat Anti-Mouse IgG HRP Conjugated Antibody | Cell Signaling | Cat#7076; RRID: AB_330924 |
Rabbit Anti-GABARAPL2 Polyclonal Antibody | In house | N/A |
Rat Anti-HA Monoclonal Antibody | Roche | Cat#11867423001; RRID: AB_390918 |
Rabbit Anti-ATG4D Polyclonal Antibody | Proteintech | Cat#16924-1-AP; RRID: AB_2062024 |
Rabbit Anti-ATG4B Polyclonal Antibody | Cell Signaling | Cat#5299; RRID: AB_10622184 |
Bacterial and virus strains | ||
Influenza A Virus PR8 (strain A/Puerto Rico/9/1934) | Fletcher et al., 2018 | N/A |
BL21-Gold (DE3) E. coli. | Agilent | Cat#230132 |
Chemicals, peptides, and recombinant proteins | ||
Bafilomycin A1 | Tocris | Cat#1334 |
PP242 | Tocris | Cat#4257 |
Monensin | Sigma | Cat#M5273 |
DAPI | Sigma | Cat#D9542 |
Human IgG | Sigma | Cat#I4506 |
Murine IFNγ | Peprotech | Cat#315-05 |
GFP-TRAP beads | Chromotek | Cat#gtma-20 |
Control magnetic agarose beads | Chromotek | Cat#bmab-20 |
Magnetic 3-micron beads | Bangs Lanoratories | Cat#PMA3N |
Latex 3-micron beads | Polysciences | Cat#17134-15 |
Zymosan | Sigma | Cat#Z4250 |
Human serum | Sigma | Cat#P2918 |
DMEM | Thermofisher | Cat#41966-029 |
DMEM F/12 | Thermofisher | Cat#11320074 |
Pen/Strep | Thermofisher | Cat#15140-122 |
N-Ethylmaleimide (NEM) | Sigma | Cat#E3876 |
Puromycin | Sigma | Cat#P8833 |
Blasticidin | Sigma | Cat#15205 |
Protease inhibitor cocktail III | Sigma | Cat#P8340 |
Phosphatase inhibitor | Sigma | Cat#P0044 |
EGF | Peprotech | Cat#AF-100-15 |
Hydrocortisone | Sigma | Cat#H0888 |
Cholera toxin | Sigma | Cat#C8052 |
Insulin | Sigma | Cat#I9278 |
2x LDS buffer | Thermofisher | Cat#NP0008 |
Imperial Stain | Thermofisher | Cat#24615 |
AspN protease | Sigma | Cat#11420488001 |
Gold anti-fade | Thermofisher | Cat#P36930 |
Anti-HA Agarose beads | Sigma | Cat#A2095 |
Recombinant His-tagged human ATG4B | Abcam | Cat#ab188707 |
Deposited data | ||
https://data.mendeley.com/datasets/f5kjfmnf2p/1 | N/A | N/A |
Experimental models: cell lines | ||
HCT116 GFP-rLC3B | Fletcher et al., 2018 | N/A |
HCT116 ATG16L1−/− GFP-rLC3B | Fletcher et al., 2018 | N/A |
HCT116 GFP-rLC3B WT clone A | Ulferts et al., 2020 (BioRxiV) | N/A |
HCT116 GFP-rLC3B ATG4D−/− | Ulferts et al., 2020 (BioRxiV) | N/A |
MCF10A GFP-hLC3A | Florey et al., 2011 | N/A |
MCF10A ATG13−/− GFP-hLC3A | Jacquin et al., 2017 | N/A |
MCF10A ATG13−/− GFP-hLC3B | This manuscript | N/A |
MCF10A ATG13−/− GFP-hLC3C | This manuscript | N/A |
MCF10A ATG13−/− GFP-hGABARAP | This manuscript | N/A |
MCF10A ATG13−/− GFP-hGABARAPL1 | This manuscript | N/A |
MCF10A ATG13−/− GFP-hGABARAPL2 | This manuscript | N/A |
J774.1A GFP-hLC3A | Florey et al., 2011 | N/A |
RAW264.7 GFP-hLC3A | This manuscript | N/A |
RAW264.7 ATG16L1−/− | Lystad et al., 2019 | N/A |
RAW264.7 ATG16L1−/− GFP-hLC3A + WT FlagS-ATG16L1 | This manuscript | N/A |
RAW264.7 ATG16L1−/− GFP-hLC3A + K490A FlagS-ATG16L1 | This manuscript | N/A |
HeLa GFP-hLC3B.G120 | Agrotis et al., 2019 | N/A |
HeLa ATG4B−/− GFP-hLC3B.G120 | Agrotis et al., 2019 | N/A |
HEK293 FT | ATCC | ATCC Cat# PTA-5077, RRID:CVCL_6911 |
Oligonucleotides | ||
ATG4D guide 1 | ggcgggacacaaagucccgc | N/A |
ATG4D guide 2 | gggacuuugugucccgccug | N/A |
ATG4D guide 3 | ccggcgguaugugagccac | N/A |
Recombinant DNA | ||
pBabe-Puro GFP-GABARAP | MRC-PPU | DU36756 |
pBabe-Puro GFP-GABARAPL1 | MRC-PPU | DU36757 |
pBabe-Puro GFP-GABARAPL2 | MRC-PPU | DU40072 |
pBabe-Puro GFP-LC3B | MRC-PPU | DU40253 |
pBabe-Puro GFP-LC3C | MRC-PPU | DU40860 |
mRFP-Lact-C2 | Addgene | Addgene plasmid Cat#74061 |