REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-SARS-CoV-2 NP mAb #7	This study	N/A
Anti-SARS-CoV-2 NP mAb #9	This study	N/A
Anti-SARS-CoV-2 NP mAb #98	This study	N/A
Anti-His-tag mAb	MEDICAL & BIOLOGICAL LABORATORIES CO., LTD.	Cat# D291-3；RRID: AB_10597733
Anti-DDDDK-tag (Flag) mAb	MEDICAL & BIOLOGICAL LABORATORIES CO., LTD.	Cat#M185-3L; RRID: AB_11123930
SARS-CoV-2 Nucleocapsid Protein Monoclonal Antibody (7E1B)	Bioss Antibodies Inc.	Cat#bsm-41414M; RRID: AB_2848129
SARS coronavirus monoclonal antibody	BiosPacific, Inc.	Cat#A03070041P
SARS coronavirus monoclonal antibody	BiosPacific, Inc.	Cat#A03080041P
Anti-Mouse IgG, HRP-Linked F(ab’)2 Fragment Sheep	Cytiva	Cat#NA9310-1ML; RRID: AB_772193
Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568	Thermo Fisher Scientific	Cat#A-11031; RRID: AB_144696
Bacterial and virus strains
SARS-CoV-2 isolate (2019-nCoV/JPN/TY/WK-521/2020)	National Institute of Infectious Diseases, Japan	N/A
SARS-CoV-2 isolate (2019-nCoV/JPN/QHN001/2021)	National Institute of Infectious Diseases, Japan	N/A
SARS-CoV-2 isolate (2019-nCoV/JPN/TY8-612/2021)	National Institute of Infectious Diseases, Japan	N/A
SARS-CoV-2 isolate (2019-nCoV/JPN/TY7-501/2021)	National Institute of Infectious Diseases, Japan	N/A
Human coronavirus OC43	American Type Culture Collection (ATCC)	Cat#VR-1558
Human coronavirus 229E	American Type Culture Collection (ATCC)	Cat#VR-740
Human rhino virus 14 (HRV14)	American Type Culture Collection (ATCC)	Cat#VR-284
Human rhino virus 14 (HRV16)	American Type Culture Collection (ATCC)	Cat#VR-283
Respiratory syncytial virus (RSV)	American Type Culture Collection (ATCC)	Cat#VR-26
Influenza A virus (IFAV) H1N1 pdm09 isolate (A/Yokohama/72/2020)	Yokohama City Institute of Public Health, Kanagawa, Japan	N/A
Influenza A virus (IFAV) H3N2 isolate (A/Yokohama/68/2020)	Yokohama City Institute of Public Health, Kanagawa, Japan	N/A
Influenza B virus (IFBV) Victoria lineage isolate (B/Yokohama/33/2020)	Yokohama City Institute of Public Health, Kanagawa, Japan	N/A
Influenza B virus (IFBV) Yamagata lineage isolate (B/Yokohama/35/2019)	Yokohama City Institute of Public Health, Kanagawa, Japan	N/A
Chemicals, peptides, and recombinant proteins
PrimeSTAR Mutagenesis Basal kit	Takara Bio Inc.	Cat#R046A
WEPRO7240H Expression Kit	CellFree Sciences Co.,Ltd.	Cat#CFS-TRI-7240H
WEPRO7240G Expression Kit	CellFree Sciences Co.,Ltd.	Cat#CFS-TRI-7240G
Hi-QRAS Gel N	Kanto Chemical Co., Inc.	Cat#49902-58
Rapid CBB KANTO 3S	Kanto Chemical Co., Inc.	Cat#36533-79
His-tagged N-terminal deleted mutant of NP (ΔN-NP; 121-419)	This study	N/A
Ni-Sepharose Fast Flow beads	Cytiva	Cat#17531801
PreScission Protease	Cytiva	Cat#27084301
ABTS Microwell Peroxidase Substrate (2-Component System)	Kirkegaard & Perry Laboratories	Cat#5120-0032
TMB 1-Component Microwell Peroxidase Substrate, SureBlue	Kirkegaard & Perry Laboratories	Cat#5120-0075
SuperSignal West Femto Maximum Sensitivity Substrate	Thermo Fisher Scientific	Cat#34095
Dulbecco’s modified Eagle’s medium (high glucose)	FUJIFILM Wako Pure Chemical Corporation	Cat#044-29765
CD hybridoma medium AGT medium	Thermo Fisher Scientific	Cat#12372025
HYGM-7 Express (Ready - to - use), Liquid, without Phenol Red, protein free	Kanto Chemical Co., Inc.	Cat#49432-50
Critical commercial assays
Standard Q COVID-19 Ag	SD. Biosensor	Cat#Q-NCOV-01G
Espline SARS-CoV-2	Fujirebio	Cat#260319
Panbio COVID-19 Ag Rapid Test	Abbott	Cat#4571226475003
SARS-CoV-2 Rapid Antigen Test	Roche	Cat#508487
Deposited data
Partial structure of SARS-CoV-2 NP-1	Zinzula et al.24	PDB: 6YUN
Full-length structural model of MERS-NP	Yamaoka et al.21	N/A
Partial structure of SARS-CoV-2 NP-2	Kang et al.23	PDB: 6M3M
Full-length structural model of SARS-CoV-2 NP	This study	https://doi.org/10.17632/7b67yg29d6.1
Multiple sequence alignment of SARS-CoV-2 NP	This study	https://doi.org/10.17632/7b67yg29d6.1
Experimental models: cell lines
HCT-8	American Type Culture Collection (ATCC)	CCL-244
MRC-5	RIKEN BioResource Research Center	RCB0211
VeroE6/TMPRSS2	Japanese Collection of Research Bioresources Cell Bank (JCRB)	JCRB1819
Oligonucleotides
Reverse primer for the quantification of SARS-CoV-2: 5′- TGGCAGCTGT GTAGGTCAAC −3′	Shirato et al.42	N/A
Probe for the quantification of SARS-CoV-2: FAM-ATGTCGCGCATTGGCATGGA-BHQ	Shirato et al.42	N/A
Forward primer for the quantification of HCoV-229E: 5′- TTCCGACGT GCTCGAACTTT −3′	Vijgen et al.43	N/A
Reverse primer for the quantification of HCoV-229E: 5′- CCAACACGGTTG TGACAGTGA −3′	Vijgen et al.43	N/A
Probe for the quantification of HCoV-229E: FAM 5′- TCCTGAGGTCAATGCA −3′ TAMRA	Vijgen et al.43	N/A
Forward primer for the quantification of HCoV-OC43: 5′- ATGTTAGGCCGATA ATTGAGGACTAT −3′	Vijgen et al.43	N/A
Reverse primer for the quantification of HCoV-OC43: 5′- AATGTAAAGA TGGCCGCGTATT −3′	Vijgen et al.43	N/A
Probe for the quantification of HCoV-OC43: FAM 5′- CATACTCTGACGGTCACAAT −3′ TAMRA	Vijgen et al.43	N/A
Forward primer for the quantification of SARS-CoV-2: 5′- AAATTTTGGGG ACCAGGAAC −3′	Shirato et al.42	N/A
Software and algorithms
ForteBio data analysis software	Fortebio	https://www.sartorius.com/en/products/protein-analysis/octet-systems-software
MODELLER9.15	Webb et al.44	https://salilab.org/modeller/9.15/release.html
Swiss PDB viewer 4.1	Guex et al.45	https://spdbv.vital-it.ch/
UCSF Chimera software 1.13.1	Pettersen et al.46	https://www.cgl.ucsf.edu/chimera/
MAFFT version 7	Kato et al.47	https://mafft.cbrc.jp/alignment/server/
MEGAX (MUSCLE)	Edgar et al.48, Kumar et al.49	https://www.megasoftware.net/
Graphpad Prism 8.43	Graphpad Software	https://www.graphpad.com/
Other
Immunochromatographic assay with silver amplification technology	This study (FUJIFILM Corporation)	Cat#16696722