KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-mouse CD3 | BioXCell | Clone: 145-2C11; Cat# BE0001-1; RRID: AB_1107634 |
| Anti-mouse CD28 | BioXCell | Clone: 37.51; Cat# BE0015-1; RRID: AB_1107624 |
| Anti-mouse IL4 | BioXCell | Clone: 11B11; Cat# BE0045; RRID: AB_1107707 |
| Anti-mouse IFNγ | BioXCell | Clone: XMG1.2; Cat# BE0055; RRID: AB_1107694 |
| Anti-mouse CD25-biotin | eBioscience | Cat# 13-0251-85; RRID: AB_466401 |
| Anti-mouse C49b-biotin | eBioscience | Cat# 13-5971-85; RRID:AB_466826 |
| Anti-mouse TER-119-biotin | eBioscience | Cat# 13-5921-85; RRID:AB_466798 |
| Anti-human/mouse CD45R-biotin | eBioscience | Cat# 13-0452-85; RRID:AB_466450 |
| Anti-mouse CD11b-biotin | eBioscience | Cat# 13-0112-85; RRID:AB_466360 |
| Anti-human/mouse CD44-biotin | eBioscience | Cat# 13-0441-85; AB_466443 |
| Anti-mouse CD8a-biotin | eBioscience | Cat# 13-0081-86; AB_466348 |
| Anti-biotin microbeads | Miltenyi Biotec | Cat# 130-090-485; AB_244365 |
| CD4-PE | eBioscience | Clone: GK5.1; Cat# 12-0041-83; RRID: AB_465506 |
| CD4-PE/Cy7 | Biolegend | Clone: GK5.1; Cat# 100422; RRID: AB_312707 |
| CD4-APC | Biolegend | Clone: GK5.1; Cat# 100412; RRID: AB_312697 |
| CD4-APC/Cy7 | Biolegend | Clone: GK5.1; Cat# 100414; RRID: AB_312699 |
| CD8-PE/Cy7 | Biolegend | Clone: 53-6.7; Cat# 100722; RRID: AB_312761 |
| CD8-APC | Biolegend | Clone: 53-6.7; Cat# 100712; RRID: AB_312751 |
| CD8-FITC | Biolegend | Clone: 53-6.7; Cat# 100706; RRID: AB_312745 |
| IL17-PE | Biolegend | Clone: TC11-18H10.1; Cat# 506904; RRID: AB_315464 |
| IL17-Pacific Blue | Biolegend | Clone: TC11-18H10.1; Cat# 506918; RRID: AB_893544 |
| IFNγ-PE | Biolegend | Clone: XMG1.2; Cat# 505808; RRID: AB_315402 |
| IFNγ-Alexa647 | Biolegend | Clone: XMG1.2; Cat# 505814; RRID: AB_493314 |
| CD25-APC | Biolegend | Cat# 102012; RRID:AB_312861 |
| IL4-PE | Biolegend | Clone 11B11 Cat# 504103 RRID AB_315317 |
| CD62L-APC | Biolegend | Clone: MEL14; Cat# 104412; RRID AB_313099 |
| CD44-PerCP/cye5.5 | Biolegend | Clone: IM7; Cat# 103032; RRID AB_2076204 |
| Vβ13-FITC | BD Biosciences | Clone: MR1 2–3; Cat# 553204; RRID: AB_394706 |
| Anti- Lass6 (CerS6) | Santa Cruz Biotechnology | sc-65127; RRID:AB_2133113 |
| Anti- Lass1 (CerS1) | Santa Cruz Biotechnology | sc-65096; RRID:AB_2132952 |
| Anti- Lass5 (CerS5) | Santa Cruz Biotechnology | sc-135038; RRID:AB_10609786 |
| Anti-Aco2 | Cell Signaling | Cat# 6922S, RRID:AB_10828218 |
| Anti-LC3B | Cell Signaling | Cat# 2775, RRID:AB_915950 |
| Anti-Tom20 | Santa Cruz Biotechnology | Cat# sc-17764, RRID:AB_628381 |
| Anti-Ceramide | Enzo | Cat# MD15B4 ALX-804–196-T050; RRID:AB_10541503 |
| Anti-p62/SQSTM1 | Cell Signaling | Cat#5114 |
| Anti-actin | Sigma-Aldrich | Cat# A2066, RRID:AB_476693 |
| Anti-FLAG | Sigma-Aldrich | Clone: 2EL-1B11 Cat# MAB3118; RRID:AB_94705 |
| Anti-Sphk1 (SK1) | Abcam | Cat# ab71700; RRID:AB_1270891 |
| Anti-Sphk2 (SK2) | Protein Tech | 17096-1-AP GenBank access. BC010671; RRID:AB_10598479 |
| Anti-Goat Alexa647 | Thermo Fisher Scientific | Clone: N/A; Cat# A21447; RRID: AB_141844 |
| Anti-DLP1 (Dynamin-like protein/Drp1) | BD Transduction | Cat# 611112; RRID:AB_398423 |
| AntI p(S637)-Drp1 | Cell Signaling Technology | Clone: N/A; Cat# 4867S; RRID:AB_10622027 |
| Anti p(S616)-Drp1 | Cell Signaling Technology | Clone:N/A; Cat#3455S; RRID:AB_2085352 |
| Anti PKA catalytic subunit Iα/β | Santa Cruz Biotechnology | Cat# sc-28315; RRID:AB_628136 |
| Anti PKA regulatory subunit Iα/β reg (B-6) | Santa Cruz Biotechnology | sc-271125; RRID:AB_10611494 |
| Anti PKA regulatory subunit IIα reg (40) | Santa Cruz Biotechnology | sc-136262; RRID:AB_2168239 |
| Anti PKA regulatory subunit IIβ reg (C-2) | Santa Cruz Biotechnology | sc-376778 |
| Anti-AKAP 149 (B-10) | Santa Cruz Biotechnology | sc-377450 |
| Anti-PINK1 (17HCLC), | ThermoFisher | Cat# 710993; RRID:AB_2633104 |
| Anti-PARKIN | ThermoFisher | Cat# 13399; RRID:AB_2159914 |
| Ac-Histone H4 (E-5) | Santa Cruz Biotechnology | sc-377520 |
| Anti-Rabbit HRP | Cell Signaling Technology | Clone: N/A; Cat# 7074S; RRID:AB_2099233 |
| Anti-Rabbit PE | Jackson ImmunoResearch Laboratories | Clone: N/A; Cat# 111-116-144; RRID: AB_2337985 |
| Anti-Rabbit Alexa647 | Jackson ImmunoResearch Laboratories | Clone: N/A; Cat# 111-607-003; RRID: AB_2338084 |
| Anti FACL-4 | Santa Cruz Biotechnology | Cat# sc365230; RRID:AB_10843105 |
| Anti VDAC | Santa Cruz Biotechnology | Cat# sc-8830 |
| Anti-cytochrome C | BD Transduction Laboratories | Cat# 556433; RRID:AB_396417 |
| Anti β-Tubulin | Cell Signaling Technology | Clone: N/A; Cat#2146S; RRID:AB_2210545 |
| Anti-IP3R3 | BD Transduction Laboratories | Cat# 610312; RRID:AB_397704 |
| inVivoMAb anti-mouse PD-1 | BioxCell | Cat# BE0146 Clone RMPI 14 RRID: RRID:AB_10949053 |
| Chemicals, peptides, and recombinant proteins | ||
| H89 | Abcam | Cat#ab120341 |
| H89 | InvivoGen | Cat# tlrl-h89 |
| PKA inhibitor peptide | Sigma-Aldrich | Cat# 12–151 |
| bcAMP | Sigma-Aldrich | Cat# B5386 |
| ABC294640 | RedHill Biopharm | Cat# ABC924640 |
| cAMP Elisa Kit | Cayman Chemical | Cat# 581001 |
| mDivi | Sigma-Aldrich | Cat#M0199 |
| Anti-rabbit Immuno-gold labeled, 1.4 nm | Nanoprobes, Inc. | #2004, #2006 |
| Anti-mouse Immuno-gold labeled 10 nm | Nanoprobes, Inc. | #2022 |
| PF-543 | Calbiochem | Cat# 567741 |
| YO-PRO®−1 iodide (491/509) | Invitrogen | Cat# Y3603 |
| MatTek | MatTek Corp. | Cat# P35GC-1.5-14-C |
| Mitotracker Red FM 581/644 | Molecular Probes | Cat# M22425 |
| Mitotracker Deep Red FM 644/665 | Molecular Probes | Cat# M22426 |
| Mitotracker Green FM 490/516 | Molecular Probes | Cat# M7514 |
| LTG 504/511 | Molecular Probes | Cat# L7526 |
| 2-Deoxy-D-glucose (2DG) | Sigma Aldrich | Cat# D6134 |
| Antimycin A | Sigma Aldrich | Cat# A8674 |
| Rotenone | Sigma Aldrich | Cat# R8875 |
| Oligomycin | Sigma Aldrich | Cat# O4876 |
| FCCP | Sigma Aldrich | Cat# C2920 |
| IMDM | GE Healthcare, HyClone | Cat# SH3022801 |
| Ficoll-paque | GE Healthcare, HyClone | Cat# 17-1440-03 |
| RPMI-1640 (Glucose free) | Thermo Fisher Scientific | Cat# 11879-020 |
| Penicillin-Streptomycin | Corning | Cat# 30-001-CI |
| Fetal Bovine Serum (FBS) | Atlanta Biologicals | Cat# S11150 |
| ACK Lysing Buffer | Thermo Fisher Scientific | A1049201 |
| Cell Strainer 40μm | Thermo Fisher Scientific | 22363547 |
| β-mercaptoethanol | Thermo Fisher Scientific | 21985023 |
| Cell-TAK | Corning | Cat# 354240 |
| rIL12 | Biolegend | Cat# 577004 |
| rIL6 | Biolegend | Cat# 575704 |
| rTGFβ | Biolegend | Cat# 580702 |
| rhIL2 | NCI, Biological Resources Branch | https://frederick.cancer.gov/Science/BrbRepository/#/preclinicalRepository |
| Fixation/Permeabilization Solution Kit | BD Biosciences | Cat# 554714 |
| gp10025–33 peptide (KVPRNQDW) | Genscript | Cat# RP20344 |
| Nucleofector Kits for Mouse T Cells | Lonza | Cat# VPA-1006 |
| RIPA Lysis Buffer | Thermo Fisher Scientific | Cat# 89900 |
| Protein inhibitors | Thermo Fisher Scientific | Cat# 78430 |
| HaltTM Phosphatase inhibitors single use 100X cocktail | Thermo Fisher Scientific | Cat# 78428 |
| Critical commercial assays | ||
| CyQUANT® Direct Cell Proliferation Assay | Thermo Fisher Scientific | Cat# C35011 |
| Cyto-ID autophagy/mitophagy detection kit | Enzo | ENZ-51031-0050 |
| LIVE/DEAD | Thermo Fisher Scientific | L34967 |
| cAMP Determination | Cayman | Cat# 581001 |
| PKA Activity in vitro | Enzo | Cat# ADI-EKS-390A |
| β-galactosidase | Invitrogen | I-2904 |
| Adenosine 5’-triphosphate (ATP) Bioluminescent Assay Kit | Sigma | Cat# FLAA-1KT |
| iScript cDNA Synthesis Kit | Biorad | Cat# 1708891 |
| SsoAdvanced Universal SYBR® Green Supermix | Biorad | Cat# 1725274 |
| CellTrace CFSE Cell Proliferation Kit | Thermo Fisher Scientific | Cat# C34554 |
| Deposited data | ||
| RNA sequencing data Title: Aging stress and ceramide dependent RNA sequencing expression profiling depends on ceramide synthase 6 | NCBI, Gene Expression Omnibus | Accession number: GSE148498 |
| Experimental models: cell lines | ||
| B16-F10 (validated cell line) | ATCC | CRL-6475 |
| Experimental models: organisms/strains | ||
| C57BL/6 | Jackson Laboratory | Stock# 000664 |
| B6.129S7-Rag1tm1Mom/J | Jackson Laboratory | Stock# 002216 |
| Prkaa1 PKAfl/fl | Jackson Laboratory | Stock# 014141 |
| CD4cre | Jackson Laboratory | Stock# 017336 |
| Pmel Sphk2−/− | Ogretmen’s Laboratory | Generated in this study |
| Pmel CerS6−/− | Ogretmen’s Laboratory | Generated in this study |
| Prkaa2 PKAfl/fl CD4cre | Ogretmen’s Laboratory | Generated in this study |
| Oligonucleotides | ||
| IL23r Forward Primer TTCAGATGGGCATGAATGTTTCT | IDT, Coralville | N/A |
| IL23r Reverse Primer CCAAATCCGAGCTGTTGTTCTAT | IDT, Coralville | N/A |
| IL-22 Forward Primer ATGAGTTTTTCCCTTATGGGGAC | IDT, Coralville | N/A |
| IL-22 Reverse Primer GCTGGAAGTTGGACACCTCAA | IDT, Coralville | N/A |
| IL-9 Forward Primer CATCAGTGTCTCTCCGTCCCAACTGAT | IDT, Coralville | N/A |
| IL-9 Reverse Primer GATTTCTGTGTGGCATTGGTCAG | IDT, Coralville | N/A |
| βactin Forward Primer ACGTAGCCATCCAGGCTGGTG | IDT, Coralville | N/A |
| βactin Reverse Primer TGGCGTGAGGGAGAGCAT | IDT, Coralville | N/A |
| SphK2 Probe: Mm00445021_m1 | ThermoFisher | Cat# 4331182 |
| SphK1 Probe: Mm00448841_g1 | ThermoFisher | Cat# 4331182 |
| CerS1 Probe: Mm03024093_mH | ThermoFisher | Cat# 4331182 |
| CerS4 Probe: Mm00482658_m1 | ThermoFisher | Cat# 4331182 |
| CerS5 Probe: Mm00510998_m1 | ThermoFisher | Cat# 4331182 |
| CerS6 Probe: Mm00556165_m1 | ThermoFisher | Cat# 4331182 |
| RPLP0 Probe: Mm00725448_s1 | ThermoFisher | Cat# 4331182 |
| Software and algorithms | ||
| FlowJo 10.2 | TreeStar, OR | https://www.flowjo.com/solutions/flowjo/downloads/ |
| Prism 8 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| Agilent Seahorse Wave 2.4 | Agilent | https://www.agilent.com/en-us/products/cell-analysis-(seahorse)/seahorse-wave-software |
| CFX Manager 3.1 | Biorad | https://www.bio-rad.com/en-us/sku/soft-cfx-31-patch-cfx-manager-software-v3-1-upgrade |
| Fiji | NIH Image | https://imagej.net/Fiji |
| FV10i | Olympus Corp. | FV10-ASW https://www.grapecity.com |