Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | 129 background - Krasex3op | Pershing et al., 2015, MMRRC | Stock 050601-UNC; MGI:5708830 | |
| Strain, strain background (Mus musculus) | B6.129 mixed background -Trp53flox/flox | The Jackson Laboratory | Stock 008462; MGI:1931011 | |
| Strain, strain background (Mus musculus) | B6.129 mixed background -SftpcCreER/CreER | Xu et al., 2012, gift from Mark Onaitis | MGI:5305340 | |
| Strain, strain background (Mus musculus) | B6.129 mixed background - SftpcCreER/CreER;Trp53flox/flox;Krasex3op | This paper | N/A | See Materials and methods section ‘Mice’ |
| Sequence-based reagent | Krasex3op genotyping F | This paper | PCR primers | TGGTAGGGTAGAAACTAGGATTC |
| Sequence-based reagent | Krasex3op genotyping R | This paper | PCR primers | GAGTACACAGAGAGACCATTTCAAC |
| Sequence-based reagent | Trp53 genotyping F | This paper | PCR primers | CACAAAAAACAGGTTAAACCCA |
| Sequence-based reagent | Trp53 genotyping WT R | This paper | PCR primers | AGCACATAGGAGGCAGAGAC |
| Sequence-based reagent | Trp53 genotyping Del R | This paper | PCR primers | GAAGACAGAAAAGGGGAGGG |
| Sequence-based reagent | Sftpc genotyping F | This paper | PCR primers | GCTTCACAGGGTCGGTAG |
| Sequence-based reagent | Sftpc genotyping R | This paper | PCR primers | GAGGCACCGCTCCGCGAG |
| Sequence-based reagent | Sftpc genotyping CreER R | This paper | PCR primers | CAACTCACAACGTGGCACTG |
| Sequence-based reagent | Tumor sequencing primers | This paper | PCR primers | Supplementary file 3 |
| Sequence-based reagent | qPCR primers | This paper | PCR primers | Supplementary file 3 |
| Sequence-based reagent | MDS assay primers | This paper | PCR primers | Supplementary file 3 |
| Peptide, recombinant protein | Proteinase K | New England Biolabs | Cat# P8107S | |
| Peptide, recombinant protein | RNase A | Sigma | Cat# R4642 | |
| Peptide, recombinant protein | EcoRV | New England Biolabs | Cat# R3195 | |
| Peptide, recombinant protein | EcoRI | New England Biolabs | Cat# R3101 | |
| Peptide, recombinant protein | XmnI | New England Biolabs | Cat# R0194 | |
| Peptide, recombinant protein | Exonuclease I | New England Biolabs | Cat# M0293 | |
| Commercial assay or kit | iScript cDNA synthesis kit | Bio-Rad | Cat# 1708890 | |
| Commercial assay or kit | Platinum Taq Polymerase | Thermo Fisher Scientific | Cat# 10966083 | |
| Commercial assay or kit | QIAquick PCR Purification Kit | Qiagen | Cat# 28104 | |
| Commercial assay or kit | Q5 Hot Start High-Fidelity DNA Polymerase | New England Biolabs | Cat# M0493 | |
| Commercial assay or kit | Agencourt AMPure XP | Beckman Coulter | Cat# A63880 | |
| Commercial assay or kit | iTaq Universal SYBR Green Supermix | Bio-Rad | Cat# 1725120 | |
| Commercial assay or kit | PrimeTime Gene Expression Master Mix | Integrated DNA Technologies | Cat# 1055770 | |
| Chemical compound, drug | Tamoxifen | Sigma | Cat# T5648 | |
| Chemical compound, drug | Corn oil | Sigma | Cat# C8267 | |
| Chemical compound, drug | Urethane | Sigma | Cat# U2500 | |
| Chemical compound, drug | RLT buffer | Qiagen | Cat# 79216 | |
| Chemical compound, drug | β-Mercaptoethanol | Thermo Fisher Scientific | Cat# 21985023 | |
| Chemical compound, drug | Trizol LS | Thermo Fisher Scientific | Cat# 10296010 | |
| Chemical compound, drug | dNTP | New England Biolabs | Cat# N0447S | |
| Chemical compound, drug | Agarose | EMD Millipore | Cat# 2120-OP | |
| Chemical compound, drug | Tris | EMD Millipore | Cat# 9210-OP | |
| Chemical compound, drug | EDTA | VWR | Cat# 97061–406 | |
| Chemical compound, drug | Sodium dodecyl sulfate | Sigma | Cat# L4509 | |
| Chemical compound, drug | Phenol | Sigma | Cat# P1037 | |
| Chemical compound, drug | Chloroform | Macron Fine Chemicals | Cat# 4440-04 | |
| Chemical compound, drug | Ethanol | VWR | Cat# 89125-190 | |
| Chemical compound, drug | 10X exonuclease I buffer | New England Biolabs | Cat# B0293S | |
| Chemical compound, drug | Sodium chloride | EMD Millipore | Cat# SX0420 | |
| Chemical compound, drug | Potassium chloride | VWR | Cat# BDH0258 | |
| Chemical compound, drug | Potassium phosphate monobasic | Sigma | Cat# 795488 | |
| Chemical compound, drug | Sodium phosphate dibasic | Sigma | Cat# RDD022 | |
| Software, algorithm | fastq-join | https://usegalaxy.org/ | Galaxy Version 1.1.2–806.1 | See Materials and methods section ‘Sequencing data analysis’ |
| Software, algorithm | Filter by Quality | https://usegalaxy.org/ | Galaxy Version 1.0.0 | See Materials and methods section ‘Sequencing data analysis’ |
| Software, algorithm | Trim | https://usegalaxy.org/ | Galaxy Version 0.0.1 | See Materials and methods section ‘Sequencing data analysis’ |
| Software, algorithm | Filter sequences by length | https://usegalaxy.org/ | Galaxy Version 1.1 | See Materials and methods section ‘Analysis of MDS data’ |
| Software, algorithm | Group | https://usegalaxy.org/ | Galaxy Version 2.1.4 | See Materials and methods section ‘Sequencing data analysis’ |
| Software, algorithm | Barcode Splitter | https://usegalaxy.org/ | Galaxy Version 1.0.0 | See Materials and methods sections ‘Sequencing data analysis’ and ‘Analysis of MDS data’ |
| Software, algorithm | PEAR pair-end read merger | Zhang et al., 2014b | Version 0.9.8 | https://cme.h-its.org/exelixis/web/software/pear/ |
| Software, algorithm | Morpheus | https://software.broadinstitute.org/morpheus | N/A | Generation of heatmaps |
| Software, algorithm | Prism | GraphPad | Version 6 |