Skip to main content
. 2021 Feb 10;159(5):1768–1781. doi: 10.1016/j.chest.2021.02.006

Table 1.

Genetic and TEM Information in This Cohort

Patient No. Gene Complementary DNA Change (Protein Change) dbSNP Type of Mutation Source GnomAD, All ACMG Guideline
Mutation State Reference TEM
Class Evidence
1 CCDC39 c.1308delG "(p.Q436Hfs∗10) NA Frameshift P None Path PVS1+PM2+PM3 Compound heterozygous Current IDA/CA/MTD
c.1167+1G→A (P?02) rs1292030955 Splicing M None Path PVS1+PM2+PP3
2 CCDC39 c.1363-2A→G (P?) NA Splicing P None Path PVS1+PM2+PP3 Compound heterozygous Current IDA/CA/MTD
c.210+1G→C (P?) NA Splicing M None Path PVS1+PM2+PP3
3 CCDC39 c.526_c.527delCT (p.L176Afs∗10) rs780175755 Frameshift P None Path PVS1+PS1+PM2 Compound heterozygous 23255504 IDA/CA/MTD
c.2542G→T (p.E848X) NA Nonsense M None Path PVS1+PM2+PP3
4/5 CCDC39 c.872delT (p.L291Xfs∗1) NA Frameshift P None Path PVS1+PM2+PP1 Compound heterozygous Current Inadequate/NA
c.833_c.834delAG (p.E278Vfs∗2) NA Frameshift M None Path PVS1+PM2+PP1
6 CCDC40 c.961C→T (p.R321X) rs754867753 Nonsense M None Path PVS1+PS1+PM2 Compound heterozygous 21131974/current IDA/CA/MTD
c.2330G→A (p.W777X) NA Nonsense P None Path PVS1+PM2+PP3
7 CCNO c.267_c.268insAGCCC (p.V90Sfs∗6) rs939597472 Frameshift P None Path PVS1 +PM2+PM5 Compound heterozygous 24747639/current NA
c.940G→T (p.E314X) NA Nonsense M None Path PVS1+PM2+PM3
8 CCNO c.262_c.263insGGCCC (p.Q88Rfs∗8) rs587777502 Frameshift M/P None Path PVS1+PS1+PM2 Homozygous 24747639 NA
9 CCNO c.262_c.263insGGCCCGGCCC (p.Q88Rfs∗51) rs587777502 Frameshift P/M None Path PVS1+PM2+PP1 Homozygous Current Oligocilia
10 DNAAF3 c.813_c.814insCGAC (p.A272Rfs∗17) NA Frameshift M None Path PVS1+PM2+PP1 Compound heterozygous Current ODA+IDA
c.677G→A (p.G226E) rs1171652733 Missense P None LP PM2+PM3+PP2+PP3
11 DNAAF3 c.271C→A (p.P91T) NA Missense P/M None LP PM1+PM2+PP3+PP4 Homozygous Current ODA+IDA
12 DNAH1 c.5356C→T (p.R1786C) rs759042431 Missense M 0.000073 LP PM1+PM2+PP3+PP4 Compound heterozygous Current NA
c.1286+7C→A (P?) rs570694571 Splicing near P None VUS PM2+BP4
13 DNAH1 c.2912G→A (p.R971H) rs190420231 Missense P 0.000097 LP PM1+PM2+PP3+PP4 Compound heterozygous Current Normal
c.11135G→A (p.R3712Q) rs200395837 Missense M 0.000065 VUS PM1+PP4
14 DNAH1 c.2610G→A (p.W870X) NA Nonsense P/M None Path PVS1+PM2+PP3 Homozygous 28577616 NA
15 DNAH1 c.3836A→G (p.K1279R) rs142595873 Missense M 0.0009 LP PM1+PM3+PP3+PP1 Compound heterozygous 25877616 NA
c.6328_6337del (p.S2110Gfs ∗19) NA Frameshift P None Path PVS1+PM2+PP1
16 DNAH11 c.4321C→T (p.R1441W) rs183489539 Missense P None VUS PM1+PM2+PP3 Compound heterozygous Current Normal
c.3025C→G (p.L1009V) rs542059067 Missense M None VUS PM2+PP3
17 DNAH11 c.4670G→T (p.C1557F) NA Missense P None LP PM1+PM2+PP3+PP4 Compound heterozygous Current NA
c.9220C→G (p.Q3074E) rs775542623 Missense M 0.000054 LP PM1+PM2+PP3+PP4
18 DNAH11 c.8005C→T (p.Q2669X) NA Nonsense P None Path PVS1+PM2+PP4 Compound heterozygous Current Normal
c.13163-2_13163-1insCAAT (P?) NA Splicing M None Path PVS1+PM2+PP4
19 DNAH11 c.3020T→G (p.L1007X) rs1480698078 Nonsense P None Path PVS1+PM2+PP4 Compound heterozygous Current NA
c.12934-3_12934-2insG (P?) NA Splicing M None Path PVS1+PM2+PP4
20 DNAH11 c.11383_11386delAGAA (p.K3797Rfs∗2) NA Frameshift De novo None Path PVS+PS2+PM2 Compound heterozygous Current CA
c.1942delT (p.W649Gfs∗19) NA Frameshift M None Path PVS1+PM2+PP4
21 DNAH11 c.6165C→G (p.Y2055X) rs184241449 Nonsense M None Path PVS1+PM2+PP3 Compound heterozygous Current Oligocilia
c.11924C→T (p.S3975L) NA Missense P None LP PM1+PM2+PM3+PP3
22 DNAH11 c.6632_6633insTGAAC (p.F2214Nfs∗24) NA Frameshift M None Path PVS1+PM2+PP4 Compound heterozygous Current NA
c.10053_10054insAA (p.T3352Kfs∗19) NA Frameshift P None Path PVS1+PM2+PP4
23 DNAH11 c.13373C→T (p.P4458L) rs72658835 Missense P None Path PS1+PM1+PM2+PP3 Compound heterozygous 22184204 NA
exon21-66del (P?) NA Deletion M None Path PVS1+PM2+PM3
24 DNAH11 c.727A→G (p.I243V) rs189000268 Missense P 0.0004 VUS PM1+PM2+BP4 Compound heterozygous Current Oligocilia
c.1452T→G (p.F484L) rs755256285 Missense M 0.000046 LP PM1+PM2+PP3+PP4
25 DNAH11 c.6937C→G (p.R2313G) NA Missense P None LP PM1+PM2+PP1+PP4 Compound heterozygous Current Oligocilia
c.5513T→A (p.V1838D) rs1336120886 Missense M None LP PM&+PM2+PP3+PP4
26 DNAH11 c.12153T→A (p.D4051E) NA Missense M None VUS PM2+PP3 Compound heterozygous Current NA
c.2485C→T (p.R829C) rs767607595 Missense P None VUS PM2+PP1
27 DNAH11 c.13276T→C (p.W4426R) rs527548552 Missense M 0.0001 LP PM1+PM2+PP1+PP3 Compound heterozygous Current NA
c.10433G→A (p.R3478Q) rs117729990 Missense P 0.0008 VUS PP3+PP4
28 DNAH11 c.10851A→T (p.R3617S) rs373667589 Missense P None VUS PM2+PP3+PP4 Compound heterozygous Current NA
c.13189C→A (p.H4397N) rs774489385 Missense M None LP PM1+PM2+PP3+PP4
29 DNAH11 c.971C→T (p.A324V) rs79874320 Missense M 0.0003 LP PM1+PM2+PM3 Compound heterozygous Current Oligocilia
c.6165C→G (p.Y2055X) rs184241449 Nonsense P None Path PVS1+PM2+PP3
30 DNAH11 c.12679A→G (p.S4227G) rs574488123 Missense P 0.0002 VUS PM2+PP1+PP4 Compound heterozygous Current conical Protrusions
c.5523G→A (p.S1841S) rs750430725 Missense M None VUS PM2+PP3+PP4
31 DNAH5 c.997C→T (p.R333X) rs771956532 Nonsense P 0.000032 Path PVS1+PM2 +PP5 Compound heterozygous Current NA
c.7918_c.7919insA (p.M2640Nfs∗18) NA Frameshift M None Path PVS1+PM2+PP4
32 DNAH5 c.12813G→A (p.W4271X) NA Nonsense P None Path PVS1+PM2+PP4 Compound heterozygous Current ODA
c.5928delA (p.A1977Pfs∗77) NA Frameshift M None Path PVS1+PM2+PP4
33 DNAH5 c.5563_c.5564insA (p.I1855Nfs∗6) rs752925056 Frameshift P None Path PVS1+PM2+PP4 Compound heterozygous 11788826 Inadequate
c.4147_c.4148delAinsTCC (p.I1383Sfs∗22) NA Frameshift M None Path PVS1+PM2+PP4
34 DNAH5 c.8029C→T (p.R2677X) rs775946081 Nonsense P None Path PVS1+PM2+PP4 Compound heterozygous 16627867 ODA
c.6647delA (p. K2216Rfs∗20) NA Nonsense M None Path PVS1+PM2+PP4
35 DNAH5 c.4114C→G (p.Q1372E) NA Missense M None LP PM1+PM2+PM5+PP3 Compound heterozygous Current ODA
gain1 exon37 (P?) NA Duplication De novo None Path PVS1+PM2+PP4
36 DNAH5 c.8383C→T (p.R2795X) rs560398270 Nonsense M None Path PVS1+PM2+PP3 Compound heterozygous 30067075/Current ODA
c.8311C→T (p.R2771C) rs769557047 Missense P None LP PM1+PM2+PM3+PP3
37 DNAH5 c.12472C→T (p.R4158W) rs3756672 Missense P 0.0023 VUS PM1+BP6 Compound heterozygous Current NA
c.13286G→A (p.R4429Q) rs61744047 Missense M 0.0023 VUS PM1+PP5+BP6
38 DNAH5 c.11023_c.11028+17delTTTAAGGTAGGTTAAACCTATGGinsC (p.F3675_K3676del) NA Deletion De novo None LP PS2+PM2+PM4+PP4 Compound heterozygous Current ODA
c.8366A→G (p.H2789R) NA Missense P None LP PS2+PM2+PM3
39 DNAH5 c.9502C→T (p.R3168X) rs863224504 Nonsense P None Path PVS1+PM2+PP4 Compound heterozygous Current NA
c.6061+1G→A (P?) rs772658660 Splicing M None Path PVS1+PM2+PP4
40 DNAI1 c.1738G→A (p.D580N) NA Missense P None LP PM1+PM2+PP3+PP4 Compound heterozygous Current ODA
c.482C→T (p.T161I) NA Missense M None LP PM1+PM2+PP1+PP4
41 DNAI1 c.1612G→A (p.A538T) rs368248592 Missense P/M 0.000065 LP PS1+PM2+PP3 Homozygous Current ODA
42 HEATR2 c.2511G→A (p.S837S) rs143524894 Synonymous P 0.000016 VUS PM2+PP1 Compound heterozygous Current NA
c.2420A→G (p.D807G) rs201177019 Missense M 0.0008 LP PM1+PM2+PP1+PP4
43 HEATR2 c.2011G→A (p.A671T) rs751454661 Missense P 0.0002 LP PS4+PM1+PM2 Compound heterozygous Current ODA+IDA
c.788G→A (p.R263Q) rs201059622 Missense M None VUS PM1+PM2+PP1
44 LRRC6 exon 8-10 del (P?) NA Deletion P/M None Path PVS1+PM2+PP4 Homozygous Current ODA+IDA
45 RSPH4A c.1454G→A (p.R485Q) rs1296082790 Missense P/M None VUS PM2+PP3+PP4 Homozygous Current CA
46 RSPH9 c.421G→A (p.V141M) rs2295947 Missense M 0.0005 VUS PM2+PP3+BP1 Compound heterozygous Current CA
c.467G→A (p.R156Q) rs201032669 Missense P None VUS PM1+PP3+PP5
47 RSPH9 c.467G→A (p.R156Q) rs201032669 Missense P None VUS PM1+PP3+PP5 Compound heterozygous 25789548 Conical protrusions
c.-41T→C (P?) NA Non-coding M None VUS PM2+PP1
48 SPAG1 c.1649_c.1650insA (p.I550Ifs∗10) NA Frameshift P None Path PVS1+PM2+PP4 Compound heterozygous Current ODA+IDA
c.691delT (p.Y231Ifs∗12) NA Frameshift M None Path PVS1+PM2+PP4
49 CCDC114 c.-41_2A→C (P?) rs963154615 Splicing P None Path PVS1+PM2+PP3 Compound heterozygous Current NA
c.705_c.706insGCAG (p.P236Afs∗11) rs1294704273 Frameshift M None Path PVS1+PM2+PM3
50 ARMC4 c.2306C→A (p.P769H) rs117515566 Missense P 0.000032 LP PM1+PM2+PP3 Compound heterozygous Current ODA
c.1679C→T (p.A560V) rs749814633 Missense M 0.000097 Path PS4+PM1+PM2+PP3
51 DNAH14 c.4172 _c.4173insAT (p.R1391Rfs∗26) rs77953334 Frameshift M 0.0031 Path PVS1+PM2+PP4 Compound heterozygous Current IDA
c.5068delG (p.G1690Vfs∗12) rs577893006 Frameshift P 0.0002 Path PVS1+PM2+PP4

ACMG = American College of Medical Genetics and Genomics; dbSNP = Single Nucleotide Polymorphism Database; GnomAD = Genome Aggregation Database; IDA = inner dynein arm; LP = likely pathogenic; M = maternal; NA = not applicable; ND = not determined; ODA = outer dynein arm; P = paternal; Path = pathogenic; TEM = transmission electron microscopy; VUS = variant of uncertain significance.