Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mycobacterium tuberculosis) | M.tb Erdman (WT, EG2) | Lab Stock | ATCC 35801 | Animal passaged |
| Strain, strain background (Escherichia coli) | DH5α | Lab Stock | ATCC SCC2197 | Plasmid maintenance strain |
| Strain, strain background (Escherichia coli) | EL350/ phAE87 | Lab Stock | Phage packaging strain | |
| Strain, strain background (Escherichia coli) | Rosetta 2 (DE3) | Millipore Sigma | Cat# 71397 | Recombinant protein expression strain |
| Strain, strain background (Mus musculus) female | C57BL/6J | Jackson Laboratory | Stock no: 000664; RRID:IMSR_JAX:000664 | |
| Strain, strain background (Mus musculus) female | B6;129P2-Nos2tm1Lau/J | Jackson Laboratory | Stock no: 002596; RRID:IMSR_JAX:002596 | |
| Gene (M. tuberculosis) | rip1 | ATCC 35801 | Erdman_3146 | |
| Gene (M. tuberculosis) | sigK | ATCC 35801 | Erdman_0488 | |
| Gene (M. tuberculosis) | sigL | ATCC 35801 | Erdman_0808 | |
| Gene (M. tuberculosis) | sigM | ATCC 35801 | Erdman_4291 | |
| Gene (M. tuberculosis) | sigD | ATCC 35801 | Erdman_3735 | |
| Gene (M. tuberculosis) | mymT | ATCC 35801 | Rv0186A | nt217703-217864 Erdman Genome |
| Gene (M. tuberculosis) | ctpV | ATCC 35801 | Erdman_1076 | |
| Gene (M. tuberculosis) | csoR | ATCC 35801 | Erdman_1074 | |
| Gene (M. tuberculosis) | nrp | ATCC 35801 | Erdman_0118 | |
| Gene (M. tuberculosis) | ppe1 | ATCC 35801 | Erdman_0113 | |
| Gene (M. tuberculosis) | rv0097 | ATCC 35801 | Erdman_0114 | |
| Gene (M. tuberculosis) | fcoT | ATCC 35801 | Erdman_0115 | |
| Gene (M. tuberculosis) | fadD10 | ATCC 35801 | Erdman_0116 | |
| Gene (M. tuberculosis) | rv0100 | ATCC 35801 | Erdman_0117 | |
| Gene (M. tuberculosis) | pdtaS | ATCC 35801 | Erdman_3533 | |
| Gene (M. tuberculosis) | pdtaR | ATCC 35801 | Erdman_1787 | |
| Genetic reagent (M. tuberculosis) | Δrip1 | Sklar et al., 2010 | MGM3206; rip1 KO | Chromosomal deletion of Erdman_3146 nt5-1212 by double crossover recombination followed by marker excision by LoxP recombination |
| Genetic reagent (M. tuberculosis) | ΔsigD | Schneider et al., 2014 | JSS0005; sigD KO | Chromosomal deletion of Erdman_3735 nt6-622 by double crossover recombination |
| Genetic reagent (M. tuberculosis) | ΔsigK | Sklar et al., 2010 | MGM3259; sigK KO | |
| Genetic reagent (M. tuberculosis) | ΔsigL | Sklar et al., 2010 | MGM3254; sigL KO | |
| Genetic reagent (M. tuberculosis) | ΔsigM | Sklar et al., 2010 | MGM3260, sigM KO | |
| Genetic reagent (M. tuberculosis) sigL sigM KO | ΔsigLΔsigM | Sklar et al., 2010 | MGM3255; sigL sigM KO | |
| Genetic reagent (M. tuberculosis) | ΔsigKΔsigLΔsigM | Schneider et al., 2014 | MGM3256; sigK sigL sigM KO | |
| Genetic Reagent (M. tuberculosis) | ΔsigKΔsigL | Sklar et al., 2010 | MGM3261; sigK sigL KO | |
| Genetic reagent (M. tuberculosis) | ΔsigKΔsigM | Sklar et al., 2010 | MGM3283; sigK sigM KO | |
| Genetic reagent (M. tuberculosis) | ΔsigKΔsigD | This study, available from corresponding author | sigK::loxP sigD::hygR; MGM3288 | Chromosomal deletion of Erdman_3735 nt6-622 by double crossover recombination MGM3259 background |
| Genetic reagent (M. tuberculosis) | ΔsigLΔsigD | This study, available from corresponding author | sigL::loxP sigD::hygR; MGM3289 | Chromosomal deletion of Erdman_3735 nt6-622 by double crossover recombination MGM3254 background |
| Genetic reagent (M. tuberculosis) | ΔsigMΔsigD | This study, available from corresponding author | sigM::loxP sigD::hygR; MGM3290 | Chromosomal deletion of Erdman_3735 nt6-622 by double crossover recombination MGM3260 background |
| Genetic reagent (M. tuberculosis) | ΔctpV | This study, available from corresponding author | ctpV::hygR | Chromosomal deletion of nt 175-2136 of Erdman_1076 by double crossover recombination |
| Genetic reagent (M. tuberculosis) | ΔcsoR | This study, available from corresponding author | csoR::hygR | Chromosomal deletion of nt 1-360 of Erdman_1074 by double crossover recombination |
| Genetic reagent (M. tuberculosis) | ΔmymT | This study, available from corresponding author | mymT::hygR | Chromosomal deletion of nt 1-162 of mymT by double crossover recombination |
| Genetic reagent (M. tuberculosis) | Δrip1ΔctpV | This study, available from corresponding author | rip1::loxP ctpV::hygR | Chromosomal deletion of nt 175-2136 of Erdman_1076 by double crossover recombination MGM3206 background |
| Genetic reagent (M. tuberculosis) | Δrip1ΔcsoR | This study, available from corresponding author | rip1::loxP csoR::hygR | Chromosomal deletion of nt 1-360 of Erdman_1074 by double crossover recombination MGM3206 background |
| Genetic reagent (M. tuberculosis) | Δrip1ΔmymT | This study, available from corresponding author | rip1::loxP mymT::hygR | Chromosomal deletion of nt 1-162 of mymT by double crossover recombination MGM 3206 background |
| Genetic reagent (M. tuberculosis) | ΔpdtaS | This study, available from corresponding author | pdtaS::hygR | Chromosomal deletion of nt1-1506 of Erdman_3533 by double crossover recombination |
| Genetic reagent (M. tuberculosis) | ΔpdtaS + Vector | This study, available from corresponding author | pdtaS::hygR:pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (M. tuberculosis) | ΔpdtaR | This study, available from corresponding author | pdtaR::hygR | Chromosomal deletion of nt 1-576 of Erdman_1787 by double crossover recombination |
| Genetic reagent (M. tuberculosis) | ΔpdtaR + vector | This study, available from corresponding author | pdtaR::hygR:pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δnrp | This study, available from corresponding author | nrp::hygR | Chromosomal deletion of nt 21-7515 of Edman_0118 by double crossover recombination |
| Genetic reagent (M. tuberculosis) | Δnrp + vector | This study, available from corresponding author | nrp::hygR: pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δnrp + WT nrp | This study, available from corresponding author | nrp::hygR: WT nrp | WT copy of nrp integrated at AttB, Erdman_0116 promoter |
| Genetic reagent (M. tuberculosis) | Δrip1ΔpdtaS | This study, available from corresponding author | rip1::loxP pdtaS::hygR | Chromosomal deletion of nt1-1506 of Erdman_3533 by double crossover recombination MGM3206 background |
| Genetic reagent (M. tuberculosis) | Δrip1ΔpdtaS + vector | This study, available from corresponding author | rip1::loxP pdtaS::hygR: pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1ΔpdtaR | This study, available from corresponding author | rip1::loxP pdtaR::hygR | Chromosomal deletion of nt 1-576 of Erdman_1787 by double crossover recombination MGM3206 background |
| Genetic reagent (M. tuberculosis) | Δrip1ΔpdtaR + vector | This study, available from corresponding author | rip1::loxP pdtaR::hygR: pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1ΔpdtaR + WT pdtaR | This study, available from corresponding author | rip1::loxP pdtaR::hygR: WT pdtaR HA | WT copy of pdtaR integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1ΔpdtaR + D65A pdtaR | This study, available from corresponding author | rip1::loxP pdtaR::hygR: D65A pdtaR HA | D65A variant of pdtaR integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1Δnrp | This study, available from corresponding author | rip1::loxP nrp::hygR | Chromosomal deletion of nt 21-7515 of Edman_0118 by double crossover recombination MGM3206 background |
| Genetic reagent (M. tuberculosis) | WT + vector | Makinoshima and Glickman, 2005 | EG2: pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (M. tuberculosis) | WT + vector | Makinoshima and Glickman, 2005 | EG2:pMV261 | Transformed with empty pMV261K episomal plasmid |
| Genetic reagent (M. tuberculosis) | Δrip1 + vector | Sklar et al., 2010 | Δrip1: pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1 + vector | Sklar et al., 2010 | rip1::loxP: pMV261 | Transformed with empty pMV261K episomal plasmid |
| Genetic reagent (M. tuberculosis) | Δrip1 + WT Rip1 | Sklar et al., 2010 Makinoshima and Glickman, 2005 | rip1::loxP: WT rip1 | Transformed with WT rip1 pMV261K episomal plasmid |
| Genetic reagent (M. tuberculosis) | Δrip1 + H21A Rip1 | Makinoshima and Glickman, 2005 | rip1::loxP: H21A rip1 | Transformed with H21A variant rip1 pMV261K episomal plasmid |
| Genetic reagent (M. tuberculosis) | Δrip1: PPE1 ORF pHSP60 | This study, available from corresponding author | rip1::loxP: PPE1 GFP ORF only | Transformed with PPE1 GFP ORF only pMV261K episomal plasmid |
| Genetic reagent (M. tuberculosis) | Δrip1: PPE1 ORF + 5' pHSP60 | This study, available from corresponding author | rip1::loxP: PPE1 GFP ORF + 5' UTR pHSP60 | Transformed with PPE1 GFP + 5' UTR pMV261K episomal plasmid |
| Genetic reagent (M. tuberculosis) | Δrip1: Rv0097-nrp pHSP60 | This study, available from corresponding author | rip1::loxP: Rv0097-nrp | Transformed with Rv0097-nrp pMV261K episomal plasmid |
| Genetic reagent (M. tuberculosis) | Δrip1 pdtaS F37X | This study, available from corresponding author | rip1::loxP pdtaS F37X | Isolated spontaneous Erdman_3533 variant in MGM3206 background |
| Genetic reagent (M. tuberculosis) | Δrip1 pdtaS F37X + vector | This study, available from corresponding author | rip1::loxP pdtaS F37X: pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1 pdtaS F37X + pdtaS | This study, available from corresponding author | rip1::loxP pdtaS F37X: WT pdtaS 10xHis | WT pdtaS 10xHis integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1 pdtaS F37X + pdtaS V54F | This study, available from corresponding author | rip1::loxP pdtaS F37X: V54F pdtaS 10xHis | V54F variant of Erdman_3533 10xHis integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1 pdtaS F37X + pdtaS H302Q/H303Q | This study, available from corresponding author | rip1::loxP pdtaS F37X: H302Q/H303Q pdtaS 10xHis | H302Q/H303Q variant of Erdman_3533 10xHis integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1 pdtaS F37X + pdtaS G443A/G445A | This study, available from corresponding author | rip1::loxP pdtaS F37X: G443A/G445A pdtaS 10xHis | G443A/G445A variant of Erdman_3533 10xHis integrated at AttB |
| Genetic reagent (M. tuberculosis) | Δrip1 pdtaS V54F | This study, available from corresponding author | rip1::loxP pdtaS V54F | Isolated spontaneous Erdman_3533 variant in MGM3206 background |
| Genetic reagent (M. tuberculosis) | Δrip1 pdtaS V54F + vector | This study, available from corresponding author | rip1::loxP pdtaS V54F: pMV306K | Empty pMV306K integrated at AttB |
| Genetic reagent (E. coli) | Rosetta 2 DE3: pET WT PdtaS | This study, available from corresponding author | Rosetta 2 DE3: pET WT PdtaS | T7lac recombinant expression of C-terminally 10xHis tagged protein |
| Genetic reagent (E. coli) | Rosetta 2 DE3: pET WT PdtaS kinase domain | This study, available from corresponding author | Rosetta 2 DE3: pET WT PdtaS kinase domain | T7lac recombinant expression of C-terminally 10xHis tagged protein |
| Genetic reagent (E. coli) | Rosetta 2 DE3: pET C53A PdtaS | This study, available from corresponding author | Rosetta 2 DE3: pET C53A PdtaS | T7lac recombinant expression of C-terminally 10xHis tagged protein |
| Genetic reagent (E. coli) | Rosetta 2 DE3: pET C57A PdtaS | This study, available from corresponding author | Rosetta 2 DE3: pET C57A PdtaS | T7lac recombinant expression of C-terminally 10xHis tagged protein |
| Genetic reagent (E. coli) | Rosetta 2 DE3: pET WT PdtaR | This study, available from corresponding author | Rosetta 2 DE3: pET WT PdtaR | T7lac recombinant expression of C-terminally 10xHis tagged protein |
| Genetic reagent (E. coli) | Rosetta 2 DE3: pET D65A PdtaR | This study, available from corresponding author | Rosetta 2 DE3: pET D65A PdtaR | T7lac recombinant expression of C-terminally 10xHis tagged protein |
| Recombinant DNA reagent | pET SUMO (plasmid) | Reverter and Lima, 2009 | pET SUMO | T7lac promoter E. coli expression vector N-terminal 10xHIS Sumo Fusion Protein |
| Recombinant DNA reagent | pET (plasmid) | This study, available from corresponding author | pET | T7lac promoter E. coli expression vector |
| Recombinant DNA reagent | PdtaS (plasmid) | This study, available from corresponding author | pET WT PdtaS 10XHIS | nt 1-1503 of Erdman_3533 fused N-terminal to Enterkinase cleavage site followed by 10xHis tag |
| Recombinant DNA reagent | PdtaS C53A (plasmid) | This study, available from corresponding author | pET C53A PdtaS 10XHIS | nt 1-1503 of Erdman_3533 C53A variant fused N-terminal to Enterkinase cleavage site followed by 10xHis tag |
| Recombinant DNA reagent | PdtaS C57A (plasmid) | This study, available from corresponding author | pET C57A PdtaS 10XHIS | nt 1-1503 of Erdman_3533 C57A variant fused N-terminal to Enterkinase cleavage site followed by 10xHis tag |
| Recombinant DNA reagent | PdtaS kinase domain (plasmid) | This study, available from corresponding author | pET WT PdtaS kinase domain 10XHIS | nt 678-1503 of Erdman_3533 variant fused N-terminal to Enterkinase cleavage site followed by 10xHis tag |
| Recombinant DNA reagent | PdtaR D65A (plasmid) | This study, available from corresponding author | pET Sumo WT PdtaR | N-terminal 10xHIS Smt3 fused to nt 1-615 of Erdman_1787 |
| Recombinant DNA reagent | PdtaR D65A (plasmid) | This study, available from corresponding author | pET Sumo D65A PdtaR | N-terminal 10xHIS Smt3 fused to nt 1-615 of Erdman_1787 D65A variant |
| Recombinant DNA reagent | Vector (plasmid) | Sklar et al., 2010 Makinoshima and Glickman, 2005 | pMV261K | Episomal M.tb plasmid |
| Recombinant DNA reagent | Vector (plasmid) | Sklar et al., 2010 Makinoshima and Glickman, 2005 | pMV306K | AttB integrating M.tb plasmid |
| Recombinant DNA reagent | pMV261K GFP (plasmid) | This study, available from corresponding author | pMV261K GFP | Episomal M.tb plasmid for C-terminal GFP fusion constructs |
| Recombinant DNA reagent | WT rip1 (plasmid) | Makinoshima and Glickman, 2005 | pHMG121 | |
| Recombinant DNA reagent | H21A rip1 (plasmid) | Makinoshima and Glickman, 2005 | pHMG141 | |
| Recombinant DNA reagent | pdtaS (plasmid) | This study, available from corresponding author | pMV306K WT PdtaS 10xHis | nt 1-1503 of Erdman_3533 tagged at C-term with 10x His |
| Recombinant DNA reagent | pdtaS V54F (plasmid) | This study, available from corresponding author | pMV306K V54F PdtaS 10xHis | nt 1-1503 of Erdman_3533 tagged at C-term with 10x His V54F variant |
| Recombinant DNA reagent | pdtaS H302Q/H303Q (plasmid) | This study, available from corresponding author | pMV306K H302Q/H303Q PdtaS 10xHis | nt 1-1503 of Erdman_3533 tagged at C-term with 10x His H302Q/H303Q variant |
| Recombinant DNA reagent | pdtaS G443A/G445A (plasmid) | This study, available from corresponding author | pMV306K G443A/H445A PdtaS 10xHIs | nt 1-1503 of Erdman_3533 tagged at C-term with 10x His G443A/G445A variant |
| Recombinant DNA reagent | pdtaR (plasmid) | This study, available from corresponding author | pMV306K WT PdtaR HA | nt 1-615 of Edman_1787 tagged at C-term with HA epitope |
| Recombinant DNA reagent | pdtaR D65A (plasmid) | This study, available from corresponding author | pMV306K D65A PdtaR HA | nt 1-615 of Edman_1787 tagged at C-term with HA epitope D65A variant |
| Recombinant DNA reagent | PPE1 ORF pHSP60 (plasmid) | This study, available from corresponding author | pMV261K ORF PPE1 GFP | nt 1-1389 of Erdman_0113 tagged at C-term with GFP |
| Recombinant DNA reagent | PPE1 ORF + 5' pHSP60 (plasmid) | This study, available from corresponding author | pMV261K ORF PPE1 GFP + 5'PPE1 | nt -222-1389 of Erdman_0113 tagged at C-term with GFP |
| Recombinant DNA reagent | Rv0097-nrp pHRP60 (plasmid) | This study, available from corresponding author | pMV261K Rv0097-nrp | nt 1 of Erdman_0114 to nt 7539 of Erdman_0118 |
| Recombinant DNA reagent | WT nrp (plasmid) | This study, available from corresponding author | pMV306 WT nrp | nt 1-96 of Erdman_0116 (predicted TSS Wadsworth) + nt 1-7539 of Erdman_0118 |
| Recombinant DNA reagent | pmsg360Hyg (plasmid) | Sklar et al., 2010 Makinoshima and Glickman, 2005 | pmsg360Hyg | Phage packaging vector for hygR allelic exchange |
| Recombinant DNA reagent | pmsg360Zeo (plasmid) | Sklar et al., 2010 Makinoshima and Glickman, 2005 | pmsg360Zeo | Phage packaging vector for zeoR allelic exchange |
| Recombinant DNA reagent | pmsg318-2 (plasmid) | Sklar et al., 2010 Makinoshima and Glickman, 2005 | pmsg318-2 | M.tb Cre recombinase expression vector |
| Recombinant DNA reagent | pmsg360Hyg CtpV flanks (plasmid) | This study, available from corresponding author | ΔctpV targeting vector | Hyg cassette flanked by 616 bp 5' CtpV nt 175 + 600 bp 3' CtpV nt 2136 |
| Recombinant DNA reagent | pmsg360 Hyg CsoR flanks (plasmid) | This study, available from corresponding author | ΔcsoR targeting vector | Hyg cassette flanked by 600 bp 5' CsoR start codon + 600 bp 3' of CsoR stop codon |
| Recombinant DNA reagent | pmsg360 Hyg MymT flanks (plasmid) | This study, available from corresponding author | ΔmymT targeting vector | Hyg cassette flanked by 600 bp 5' MymT start codon + 600 bp 3' of MymT stop codon |
| Recombinant DNA reagent | pmsg360 Hyg pdtaS flanks (plasmid) | This study, available from corresponding author | ΔpdtaS targeting vector | Hyg cassette flanked by 600 bp 5' PdtaS start codon + 579 bp 3' PdtaS stop codon |
| Recombinant DNA reagent | pmsg360 Hyg pdtaR flanks (plasmid) | This study, available from corresponding author | ΔpdtaR targeting vector | Hyg cassette flanked by 600 bp 5' PdtaR start codon + 647 bp 3' PdtaR nt 576 |
| Recombinant DNA reagent | pmsg360 Hyg nrp Flanks (plasmid) | This study, available from corresponding author | Δnrp targeting vector | Hyg cassette flanked by 621 bp 5' nrp nt 21+ 621 bp 3' nrp nt 7515 |
| Sequence-based reagent | oSigA-1 | Integrated DNA Technologies | qPCR primer | cgtcttcatcccagacgaaat |
| Sequence-based reagent | oSigA-2 | Integrated DNA Technologies | qPCR primer | cgacgaagaccacgaagac |
| Sequence-based reagent | oCtpV-1 | Integrated DNA Technologies | qPCR primer | gtgtcccatgttcgaggtcaa |
| Sequence-based reagent | oCtpV-2 | Integrated DNA Technologies | qPCR primer | gtcaatgttcttcggtgcttac |
| Sequence-based reagent | oLpqS-1 | Integrated DNA Technologies | qPCR primer | gcatcgagttgtccaccag |
| Sequence-based reagent | oLpqS-2 | Integrated DNA Technologies | qPCR primer | tcaatgtggctcacccaaac |
| Sequence-based reagent | oMymT-1 | Integrated DNA Technologies | qPCR primer | gggtgatacgaatgacgaacta |
| Sequence-based reagent | oMymT-2 | Integrated DNA Technologies | qPCR primer | acagtggcatgggacttc |
| Sequence-based reagent | o2625c-F | Integrated DNA Technologies | qPCR primer | tcttgatcgcgttgggattg |
| Sequence-based reagent | o2625c-R | Integrated DNA Technologies | qPCR primer | cccggcgaattgatgtagag |
| Sequence-based reagent | oDesR-F | Integrated DNA Technologies | qPCR primer | tctgatcctcacgtcctacac |
| Sequence-based reagent | oDesR-R | Integrated DNA Technologies | qPCR primer | agcgcccacatctttgac |
| Sequence-based reagent | oHspX-F | Integrated DNA Technologies | qPCR primer | gaattcgcgtacggttccttc |
| Sequence-based reagent | oHspX-R | Integrated DNA Technologies | qPCR primer | gccaccgacacagtaagaatg |
| Sequence-based reagent | oPdtaS_C53A-F | Integrated DNA Technologies | PCR primer | gcgacgacggtgtcctggtggcggttgcg |
| Sequence-based reagent | oPdtaS_C53A-R | Integrated DNA Technologies | PCR primer | cgcaaccgccaccaggacaccgtcgtcgc |
| Sequence-based reagent | oPdtaS_C57A-F | Integrated DNA Technologies | PCR primer | gcgcaagcccggccgaacaccgggccgacg |
| Sequence-based reagent | oPdtaS_C57A-R | Integrated DNA Technologies | PCR primer | cgtcggcccggtgttcggccgggcttgcgc |
| Sequence-based reagent | oPdtaR_D65A-F | Integrated DNA Technologies | PCR primer | gtgatcatggccgtgaaga |
| Sequence-based reagent | oPdtaR_D65A-R | Integrated DNA Technologies | PCR primer | tcttcacggccatgatcac |
| Sequence-based reagent | oPdtaS_H302Q/H303Q-F | Integrated DNA Technologies | PCR primer | gggaaatccagcagcgggtt |
| Sequence-based reagent | oPdtaS_H302Q/H303Q-R | Integrated DNA Technologies | PCR primer | aacccgctgctggatttccc |
| Sequence-based reagent | oPdtaS_G443A/G445A-F | Integrated DNA Technologies | PCR primer | acgacgcgcttgctctgccg |
| Sequence-based reagent | oPdtaS_G443A/G445A-F | Integrated DNA Technologies | PCR primer | cggcagagcaagcgcgtcgt |
| Sequence-based reagent | Sense5'PPE1-F | Integrated DNA Technologies | PCR primer; in vitro transcription | taatacgactcactatagggggccgactaacaccgcgg |
| Sequence-based reagent | Sense5'PPE1-R | Integrated DNA Technologies | PCR primer; in vitro transcription | ggtttgctcaagccaggc |
| Sequence-based reagent | Rv3864-F | Integrated DNA Technologies | PCR primer; in vitro transcription | taatacgactcactataggcaaaaaattcgtgcaccaacc |
| Sequence-based reagent | Rv3864-R | Integrated DNA Technologies | PCR primer; in vitro transcription | tttccttacgctcgccgt |
| Sequence-based reagent | AntiDNAK-F | Integrated DNA Technologies | PCR primer; in vitro transcription | gatccacctagttctagaatggctcgtgcggtcg |
| Sequence-based reagent | AntiDNAK-R | Integrated DNA Technologies | PCR primer; in vitro transcription | taatacgactcactatagggggcgtcattgaagtaggcg |
| Antibody | Anti E. coli RNA polymerase B antibody (α-Rpoβ) | BioLegend | 663903 (RRID:AB_2564414) | 1:10,000 dilution |
| Antibody | Anti-HA.11 epitope tag antibody (α-HA) | BioLegend | 901513 (RRID:AB_2565335) | 1:1000 dilution |
| Antibody | α-CarD (Rabbit) | Pocono Rabbit Farm | Stallings et al., 2009 | 1:10,000 dilution |
| Antibody | α-MymT (Rabbit) | Gold et al., 2008 | 1:1000 dilution | |
| Antibody | Anti-GFP(Rabbit) Antibody (α-GFP) | Rockland | 600-401-215L (RRID:AB_2612813) | 1:1000 dilution |
| Chemical compound, drug | Spermine NONOate | Millipore Sigma | 567703 | |
| Chemical compound, drug | Diethylenetriamine/nitric oxide adduct (DETA-NO) | Millipore Sigma | D185 | |
| Chemical compound, drug | Hydrogen peroxide, 30% | Fisher Scientific | H325-100 | |
| Chemical compound, drug | Sodium hydrosulfide hydrate | Fisher Scientific | AC296200250 | |
| Commercial assay, kit | In-Fusion HD Cloning Kit | Takara Bio USA | 639650 | |
| Commercial assay, kit | Maxima H Minus cDNA Synthesis Master Mix, with dsDNase | Thermo Fisher Scientific | M1681 | |
| Commercial assay, kit | DyNAmo Flash SYBR Green qPCR Kit | Thermo Fisher Scientific | F415F | |
| Commercial assay, kit | HiScribe T7 High Yield RNA Synthesis Kit | New England Biolabs | E2040S | |
| Commercial assay, kit | Ribo-Zero Magnetic Bacterial Kit | Epicentre | MRZB12424 | |
| Commercial assay, kit | TruSeq Stranded Total RNA kit | Illumina | 20020599 | |
| Commercial assay, kit | KAPA Hyper Prep Kit | Roche | 7962312001 | |
| Commercial assay, kit | TruSeq SBS Kit v3 | Illumina | FC-401-3002 | |
| Commercial assay, kit | GeneJET RNA Purification Kit | Fisher Scientific | FERK0731 | |
| Commercial assay, kit | TURBO DNA-free kit | Fisher Scientific | AM1907 | |
| Peptide, recombinant protein | Phusion High Fidelity Polymerase | Fisher Scientific | F530L | |
| Commercial assay, kit | GeneJET Plasmid Miniprep Kit | Fisher Scientific | FERK0503 | |
| Commercial assay, kit | NanoTemper Technologies Inc PROTEIN LABELING KIT RED-NHS (MOL011) | Fisher Scientific | NC1491187 | |
| Commercial assay, kit | NanoTemper Technologies Inc Standard capillaries |
Fisher Scientific | NC1408770 | |
| Software, algorithm | ViennaRNA Web Services | http://www.viennarna.at/forna/; RRID:SCR_008550 | ||
| Software, algorithm | fastqc | http://www.bioinformatics.babraham.ac.uk/projects/fastqc | RRID:SCR_014583 | |
| Software, algorithm | bwa mem | Li et al., 2009 | RRID:SCR_010910 | |
| Software, algorithm | samtools | Li et al., 2009 | RRID:SCR_002105 | |
| Software, algorithm | Bioconductor Rsubread package | Liao et al., 2019 | RRID:SCR_016945 | |
| Software, algorithm | DESeq2 R package | Love et al., 2014 | RRID:SCR_015687 | |
| Software, algorithm | R | The R Project for Statistical Computing; https://www.R-project.org/ | RRID:SCR_001905 | |
| Software, algorithm | GATK | Broad Institute; https://gatk.broadinstitute.org/hc/en-us | RRID:SCR_001876 | |
| Software, algorithm | pheatmap | https://www.rdocumentation.org/packages/pheatmap/versions/0.2/topics/pheatmap | RRID:SCR_016418 | |
| Other | NUPAGE 4-12% BT Gel | Fisher Scientific | NPO312BOX/NPO336BOX | |
| Other | Protran Nitrocellulose Hybridization Transfer Membrane | Perkin Elmer | NBA08C001EA | |
| Other | Immun-Blot PVDF Membrane | Bio-Rad | 1620177 | |
| Other | NanoTemper Technologies Premium Capillaries | Fisher Scientific | NC1408772 | |
| Other | HisProbe-HRP Conjugate | Thermo Fisher Scientific | 15165 |