Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2021 May 6;9:651579. doi: 10.3389/fcell.2021.651579

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

Copyright © 2021 Zhang, Yang, Li, Bu, Li, Ma, Wang, Ma, Lu, Zhang, Liu, Zhao, Zhu, Qin, Cui, Liu, Liu, Fan and Liu.

This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

PMC Copyright notice

Pyk2-shRNA lentivirus transfection efficiency observation of human umbilical vein endothelial cells (HUVECs). (A) Fluorescence results of HUVECs infected with different targeting sequences of Pyk2 gene (×200). Scale bar: 100 μm; target sequence (NC: GCTTCGCGCCGTAGTCTTA; Pyk2-shRNA-1: GCTACTTGCCAGAAGACTTCA; Pyk2-shRNA-2: GCAGCATAGAGTCAGACATCT; Pyk2-shRNA-3: GCTGTACTCACTGCAGATATG; Pyk2-shRNA-4: GCGGCAAATCCTGGACAAACA). (B) Protein expression results of HUVECs infected by different Pyk2-shRNA lentivirus. (C) mRNA expression results of HUVECs infected by different Pyk2-shRNA lentivirus. Data are shown as mean ± SD of at least three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001 versus NC group, one-way ANOVA.