KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-tau p-S202/T205 (AT8) | Invitrogen | Cat#MN1020 RRID: AB_223647 |
| Rabbit polyclonal anti-tau p-S262 | Invitrogen | Cat#44-750G RRID: AB_2533743 |
| Rabbit polyclonal anti-tau p-S356 | Invitrogen | Cat#44-751G RRID: AB_2533744 |
| Rabbit polyclonal anti-tau p-S396 | Invitrogen | Cat#44-752G RRID: AB_2533745 |
| Rabbit polyclonal anti-tau ac-K280 | Dr. Todd Cohen | Cohen et al., 2011 |
| Rabbit polyclonal anti-tau ac-K369 | Dr. Todd Cohen | Cohen et al., 2013 |
| Rabbit polyclonal anti-tau (K9JA) | Dako | Cat#A0024 RRID: AB_10013724 |
| Mouse monoclonal anti-tau (T49) | Millipore | Cat#MABN827 RRID: AB_2848143 |
| Mouse monoclonal anti-c-Myc (9E10) | Santa Cruz | Cat#sc-40 RRID: AB_627268 |
| Rabbit polyclonal anti-c-Myc | Sigma | Cat#C3956 RRID: AB_439680 |
| Rabbit polyclonal anti-mHDAC6 | Dr. Tso-Pang Yao | Gao et al., 2007 |
| Rabbit polyclonal anti-HDAC6 | Millipore | Cat#07-732 RRID: AB_441966 |
| Rabbit polyclonal anti-hHDAC6 (H-300) | Santa Cruz | Cat#sc-11420 RRID: AB_2116634 |
| Rabbit polyclonal anti-HDAC6 p-S22 | Abcam | Cat#ab61058 RRID: AB_942257 |
| Mouse monoclonal anti-acetylated tubulin | Sigma | Cat#T7451 RRID: AB_609894 |
| Mouse monoclonal anti-alpha tubulin (DM1A) | Santa Cruz | Cat#sc-32293 RRID: AB_628412 |
| Rabbit polyclonal anti-acetylated-lysine | Cell Signaling | Cat#9441 RRID: AB_331805 |
| Mouse monoclonal anti-acetylated-lysine | Cell Signaling | Cat#9681 RRID: AB_331799 |
| Rabbit polyclonal anti-MAP2 | Millipore | Cat#AB5622 RRID: AB_91939 |
| Mouse monoclonal anti-TUBB3 (TUJ1) | BioLegend | Cat#801202 RRID: AB_10063408 |
| Rabbit polyclonal anti-acetyl Histone H3 (acetyl K27) | Abcam | Cat#ab177178 RRID: AB_2828007 |
| Rabbit polyclonal anti-Histone H3 | Cell Signaling | Cat#2650 RRID: AB_2115124 |
| Mouse monoclonal anti-LAMP1 | Enzo | Cat#ADI-VAM-EN001 RRID: AB_10630197 |
| Rabbit polyclonal anti-Rab5A | Santa Cruz | Cat#sc-309 RRID: AB_632295 |
| Chicken polyclonal anti-EEA1 | Invitrogen | Cat#405700 RRID: AB_596712 |
| Rabbit polyclonal anti-LC3B | Cell Signaling | Cat#2775S RRID: AB_915950 |
| Rabbit polyclonal anti-GAPDH | Millipore | Cat#ABS16 RRID: AB_10806772 |
| Alexa Fluor 594 Phalloidin | Invitrogen | Cat#A12381 |
| Bacterial and virus strains | ||
| BL21-CodonPlus (DE3)-RIL E. coli | Agilent | Cat#230245 |
| NEB® Stable Competent E. coli | New England Biolabs | Cat#C3040I |
| NEB® 5-alpha F’Iq Competent E. coli | New England Biolabs | Cat#C2992I |
| NEB® 5-alpha Competent E. coli | New England Biolabs | Cat#C2988J |
| Chemicals, peptides, and recombinant proteins | ||
| Recombinant hTauRD-P301L-K280Q | This paper | N/A |
| Recombinant hTauRD-P301L-K280R | This paper | N/A |
| Recombinant hTauFL-ΔR1-4 | Dr. Todd Cohen | Trzeciakiewicz et al., 2020 |
| Recombinant hTauRD | Dr. Todd Cohen | Trzeciakiewicz et al., 2017 |
| Recombinant hTauRD-P301L | Dr. Todd Cohen | Trzeciakiewicz et al., 2017 |
| Heparin | Sigma | Cat#H3393 |
| Thioflavine T | MP Biomedicals | Cat#156877 |
| Sodium arsenite | Sigma | Cat#S7400 |
| 3-Methyladenine | Sigma | Cat#M9281 |
| MG-132 | Sigma | Cat#M7449 |
| Tubastatin A hydrochloride | Sigma | Cat#SML0044 |
| C646 | Sigma | Cat#SML0002 |
| Critical commercial assays | ||
| FLUOR DE LYS® HDAC6 fluorometric drug discovery kit | Enzo | Cat#BML-AK516 |
| Lambda Protein Phosphatase (Lambda PP) | New England Biolabs | Cat#P0753 |
| CytoTox 96® Non-Radioactive Cytotoxicity Assay | Promega | Cat#G1780 |
| CellTiter 96® Non-Radioactive Cell | Promega | Cat#G4000 |
| Proliferation Assay | ||
| Experimental models: Cell lines | ||
| 293A Cell Line | Invitrogen | Cat#R70507 |
| Lenti-X 293T Cell Line | TaKaRa | Cat#632180 |
| Experimental models: Organisms/strains | ||
| B6.129X1-Mapttm1Hnd/J | Jackson Lab | Cat#007251 |
| Oligonucleotides | ||
| pUltra-hHDAC6 FW primer: ttataccggtgccaccatgacctcaaccggccag |
This paper | N/A |
| pUltra-hHDAC6 RV primer: ggccgtcgacgggccctctagtttatttatcatcatcatc |
This paper | N/A |
| pUltra-hTau FW primer: ccgaccggtgccaccatggctgagccccgccag; |
This paper | N/A |
| pUltra-hTau RV primer: cgcgtcgactcacaaaccctgcttggccagg |
This paper | N/A |
| Recombinant DNA | ||
| pRK172-hTauRD-P301L-K280Q | This paper | N/A |
| pRK172-hTauRD-P301L-K280R | This paper | N/A |
| pRK172-hTauRD-P301L | Dr. Virginia Lee | N/A |
| pRK172-hTauRD | Dr. Virginia Lee | N/A |
| pcDNA5/TO-hTauFL | Dr. Virginia Lee | N/A |
| pcDNA5/TO-hTauFL-P301L | Dr. Virginia Lee | N/A |
| Software and algorithms | ||
| Prism 9 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| LI-COR Image Studio | LI-COR | https://www.licor.com/bio/image-studio-lite/ |
| ImageQuant TL | Cytiva | https://www.cytivalifesciences.com/en/us/shop/protein-analysis/molecular-imaging-for-proteins/imaging-software/imagequant-tl-8-2-image-analysis-software-p-09518 |
| Photoshop | Adobe | https://www.adobe.com/products/photoshop.html |