Skip to main content
. 2021 May 6;10:e61804. doi: 10.7554/eLife.61804

Key resources table.

Reagent type
(species)
or resource
Designation Source
or reference
Identifiers Additional
information
Antibody 5E1
(mouse monoclonal)
Developmental Studies Hybridoma Bank RRID:AB_528466 Shh; (1:50)
Antibody GAPDH
(goat polyclonal)
SICGEN RRID:AB_0049-200 Loading control whole-cell lysates, western blots (1:1000)
Antibody 12/101 (mouse monoclonal) Developmental Studies Hybridoma Bank RRID:AB_531892 Skeletal muscle;
(1:100)
Antibody Sox2
(goat polyclonal)
R&D AF2018, RRID:AB_355110 Neural stem cells; (1:300-1:400)
Antibody P-H3
(rabbit polyclonal)
Millipore 06-570, RRID:AB_310177 Mitotic marker; (1:400)
Antibody P-CREB
(rabbit polyclonal)
Cell Signaling 9198 Phosphorylated transcription factor; (1:800-1:1500)
Antibody Gli2
(goat polyclonal)
R&D AF3635; RRID:AB_211902 Transcription factor; (1:800)
Antibody Lamin-B1
(rabbit monoclonal)
Cell Signaling 9087; RRID:AB_10896336 Nuclear protein for loading control in western blot assays; (1:500)
Recombinant DNA reagent p8xGli-EGFP_CMV-iRFP670 This paper Gli activity reporter; design described in Materials and methods/Gli activity reporter section of this paper
Sequence-based reagent Gli2-morpholino Gene Tools GCACAGAACGCAGGTAATGCTCCAT
Sequence-based reagent Gli2-photo-morpholino Gene Tools ATGGAGCATTACPTGCGTTCT
Chemical compound, drug Cyclopamine Sigma-Aldrich C4116 10–20 mM stock in DMSO
Chemical compound, drug SAG Calbiochem 566660 5 mM stock in H2O
Chemical compound, drug Vismodegib Sigma 879085-55-9 50 mM in DMSO
Chemical compound, drug KT5720 Tocris 1288 10 mM stock in DMSO
Chemical compound, drug GANT61 Tocris 3191 10 mM srock in DMSO
Chemical compound, drug Tricaine-S Syndel MS 222 Anesthetic