Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | 5E1 (mouse monoclonal) |
Developmental Studies Hybridoma Bank | RRID:AB_528466 | Shh; (1:50) |
| Antibody | GAPDH (goat polyclonal) |
SICGEN | RRID:AB_0049-200 | Loading control whole-cell lysates, western blots (1:1000) |
| Antibody | 12/101 (mouse monoclonal) | Developmental Studies Hybridoma Bank | RRID:AB_531892 | Skeletal muscle; (1:100) |
| Antibody | Sox2 (goat polyclonal) |
R&D | AF2018, RRID:AB_355110 | Neural stem cells; (1:300-1:400) |
| Antibody | P-H3 (rabbit polyclonal) |
Millipore | 06-570, RRID:AB_310177 | Mitotic marker; (1:400) |
| Antibody | P-CREB (rabbit polyclonal) |
Cell Signaling | 9198 | Phosphorylated transcription factor; (1:800-1:1500) |
| Antibody | Gli2 (goat polyclonal) |
R&D | AF3635; RRID:AB_211902 | Transcription factor; (1:800) |
| Antibody | Lamin-B1 (rabbit monoclonal) |
Cell Signaling | 9087; RRID:AB_10896336 | Nuclear protein for loading control in western blot assays; (1:500) |
| Recombinant DNA reagent | p8xGli-EGFP_CMV-iRFP670 | This paper | Gli activity reporter; design described in Materials and methods/Gli activity reporter section of this paper | |
| Sequence-based reagent | Gli2-morpholino | Gene Tools | GCACAGAACGCAGGTAATGCTCCAT | |
| Sequence-based reagent | Gli2-photo-morpholino | Gene Tools | ATGGAGCATTACPTGCGTTCT | |
| Chemical compound, drug | Cyclopamine | Sigma-Aldrich | C4116 | 10–20 mM stock in DMSO |
| Chemical compound, drug | SAG | Calbiochem | 566660 | 5 mM stock in H2O |
| Chemical compound, drug | Vismodegib | Sigma | 879085-55-9 | 50 mM in DMSO |
| Chemical compound, drug | KT5720 | Tocris | 1288 | 10 mM stock in DMSO |
| Chemical compound, drug | GANT61 | Tocris | 3191 | 10 mM srock in DMSO |
| Chemical compound, drug | Tricaine-S | Syndel | MS 222 | Anesthetic |