Skip to main content
. 2021 May 4;10:e61618. doi: 10.7554/eLife.61618

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Gene (Mus musculus) Draxin Mus musculus genome resource 70433
Strain, strain background (Mus musculus) BTBR T + Itpr3tf/J The Jackson Laboratory 002282
Strain, strain background (Mus musculus) C57Bl/6J The Jackson Laboratory 000664
Cell line (Homo sapiens) Human embryonic kidney (HEK) 293T ATCC RRID:CVCL_0045 ATCC Cat# CRL-1573, obtained via the University of Queensland
Antibody Sheep polyclonal anti-DRAXIN R&D Systems AF6149, RRID:AB_10640005 ‘(1:250)’
Antibody Mouse monoclonal anti-human KI67 BD Pharmingen 550609, RRID:AB_393778 ‘(1:500)’
Antibody Mouse monoclonal anti-GAP43 Millipore MAB347, RRID:AB_94881 ‘(1:500)’
Antibody Rabbit polyclonal anti-GFP Thermo Fisher Scientific A-6455, RRID:AB_221570 ‘(1:1000)’
Antibody Rabbit polyclonal anti-GFAP Dako Z0334, RRID:AB_10013382 ‘(1:500)’
Antibody Mouse monoclonal anti-Glast (EAAT1) Abcam Ab49643, RRID:AB_869830 ‘(1:500)’
Antibody Rabbit polyclonal anti-Glast (EAAT1) Abcam Ab416, RRID:AB_304334 ‘(1:250)’
Antibody Chicken polyclonal anti-Laminin LS-Bio C96142, RRID:AB_2033342 ‘(1:500)’
Antibody Rabbit polyclonal anti-Laminin (pan-Laminin) Sigma L9393, RRID:AB_477163 ‘(1:500)’
Antibody Rat monoclonal anti-Nestin (NES) Developmental Studies Hybridoma Bank AB 2235915, RRID:AB_2235915 ‘(1:50)’
Antibody Rabbit polyclonal anti-SOX9 Merck AB5535, RRID:AB_2239761 ‘(1:500)’
Antibody Goat anti-β-ACTIN SCIGEN AB0145-200, N/A ‘(1:1000)’
Recombinant DNA reagent pPBCAG-IRES-GFP Chen et al., 2020
Recombinant DNA reagent pGEMT Promega A1360
Sequence-based reagent Draxin_riboprobe_F Allen Brain Atlas CAGGGAGGTTTAGGACAAACAG
Sequence-based reagent Draxin_riboprobe_R Allen Brain Atlas TGTAGGAGCTGAGGGAAAGAAG
Sequence-based reagent Draxin_CDS_F This paper GAATTCGACAGGGAGAGCCAATG
Sequence-based reagent Draxin_CDS_R This paper GCGGCCGCGTACTGGGCGTACACCTGCT
Sequence-based reagent Chromosome 4, SNP rs6397070 forward This paper TTTATGGCTGGGGACTTCAG
Sequence-based reagent Chromosome 4, SNP rs6397070 reverse This paper CGAATCCAAAGCTCTCTTGC
Sequence-based reagent Chromosome 9, SNP rs29890894, forward This paper AGCTTGGTGGCATCCATATC
Sequence-based reagent Chromosome 9, SNP rs29890894, reverse This paper GCACTCTCCCTACTGCTTGG
Sequence-based reagent Chromosome 15, SNP rs31781085 forward This paper GATCGTTGCAGTGACCACAC
Sequence-based reagent Chromosome 15, SNP rs31781085 reverse This paper GCTGATTGGCAGGTTCTGAT
Sequence-based reagent Draxin allele genotyping, wildtype forward This paper AGACGGTCCCTGCGTCTC
Sequence-based reagent Draxin allele genotyping, mutant forward This paper GTCGCAGACGGTCCCTTG
Sequence-based reagent Draxin allele genotyping, common reverse This paper AGGCTTCCCAGATGACACTC
Commercial assay, kit Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye Invitrogen C10337
Commercial assay, kit Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 555 dye Invitrogen C10338
Software, algorithm Fiji Fiji RRID:SCR_002285
Software, algorithm Prism GraphPad RRID:SCR_002798
Software, algorithm Imaris Bitplane N/A
Other 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) Invitrogen D1306 ‘(1:750)’