| Antibodies |
|
| Anti-GFP |
Novus Biologicals |
Cat# NB600-308; RRID:AB_10003058 |
| Anti-Itih2 |
Novus Biologicals |
Cat# NBP2-31750 |
| Anti-β-Actin |
Cell Signaling Technology |
Clone 13E5, Cat# 4970; RRID:AB_2223172 |
| PE anti-mouse CD45 |
Biolegend |
Cat# 103106; RRID:AB_312971 |
| PE Rat IgG2a, κ Isotype Ctrl |
Biolegend |
Cat# 400508; RRID:AB_326530 |
| PE anti-mouse CD31 |
Biolegend |
Cat# 102508; RRID:AB_312915 |
| PE Rat IgG2b, kappa Isotype Ctrl |
Biolegend |
Cat# 400608; RRID:AB_326552 |
| Alexa Fluor® 488 anti-mouse CD326 (Ep-CAM) |
Biolegend |
Cat# 118210; RRID:AB_1134099 |
| Alexa Fluor® 488 Rat IgG2a, κ Isotype Ctrl |
Biolegend |
Clone RTK2758; Cat# 400525 |
| PE/Cy7 anti-mouse Ly-6A/E (Sca-1) |
Biolegend |
Cat# 108114; RRID:AB_493596 |
| PE/Cy7 Rat IgG2a, κ Isotype Ctrl |
Biolegend |
Cat# 400522; RRID:AB_326542 |
| CD90 / Thy1 antibody [G7] |
Abcam |
Cat# ab25322; RRID:AB_470438 |
| Rat IgG2b kappa Isotype Control (eB149/10H5), APC-eFluor 780 |
Thermo Fisher Scientific |
Cat# 47-4031-80; RRID:AB_1272021 |
| Anti-rabbit IgG, HRP-linked Antibody |
Cell Signaling Technology |
Cat# 7074; RRID: AB_2099233 |
| Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 |
Thermo Fisher Scientific |
Cat# A10042; RRID:AB_2534017 |
| Alexa Fluor 568 Phalloidin |
Thermo Fischer Scientific |
Cat# A12380 |
|
| Bacterial and virus strains |
|
| Bacteria: Subcloning Efficiency DH5α Competent Cells |
Thermo Fischer Scientific |
Cat# 18265017 |
|
| Biological samples |
|
| Human Lung Adenocarcinoma tissue |
UT MD Anderson Cancer Center |
N/A |
| Human IPF tissue |
The University of California San Francisco |
N/A |
|
| Chemicals, peptides, and recombinant proteins |
|
| DAPI |
Thermo Fischer Scientific |
Cat# R37606
|
| Collagenase type I (CLSS-1 filtered) |
Worthington Biochemical |
Cat# LS004216
|
| Dispase II |
Roche |
Cat# 04942078001 |
| RBC buffer |
Biolegend |
Cat# 420301 |
| Puromycin |
InvivoGene |
Cat#ant-pr |
| Blasticidin |
InvivoGene |
Cat# ant-bl-1 |
| Matrigel |
Corning |
Cat# 356231 |
| CellTracker Deep Red Dye |
Fisher Scientific |
Cat# C34565
|
| Collagen R solution 0.4% |
Serva |
Cat# 47256.01 |
| Protease inhibitor GM6001 |
MD Millipore |
Cat# 364206-1MG |
| paraformaldehyde |
Electron Microscopy Sciences |
Cat# 15714-S |
| JetPRIME® transfection reagent |
Polyplus |
Cat# 114-15 |
| Pluronic F-127 |
Sigma-Aldrich |
Cat# p2443-250G |
| PCR-grade mineral oil |
Sigma-Aldrich |
Cat# No. M8662 |
| RnaseOUT |
Thermo Fischer Scientific |
Cat# 10777019 |
| Superscript III |
Thermo Fischer Scientific |
Cat# 18080093 |
| Bst 2.0 WarmStart® DNA Polymerase |
NEB |
Cat# M0538S |
| AMPure XP beads |
Beckman Coulter |
Cat#. A63880 |
| Duplex-specific Nuclease |
Evrogen |
Cat# EA003 |
| KAPA HIFI Hotstart Ready Mix |
KAPA Biosystem |
Cat# KK2601 |
|
| Critical commercial assays |
|
| RNeasy Mini Kit |
QIAGEN |
Cat# 74106 |
| qScript cDNA SuperMix |
QuantaBio |
Cat# 101414-106 |
| WST-1 |
Takara |
Cat# MK400 |
| SuperSignal West Femto Maximum Sensitivity Substrate |
Thermo Fischer Scientific |
Cat# 34096 |
| Nextera DNA library prep kit |
Illumina |
Cat# FC-121-1030 |
| NextSeq 500/550 High Output Kit v2.5 (150 Cycles) |
Illumina |
Cat# 20024907 |
| NextSeq 500/550 Mid Output Kit v2.5 (150 Cycles) |
Illumina |
Cat# 20024904 |
| NEBNext Poly(A) mRNA Magnetic Isolation Module |
NEB |
Cat# E7490 |
| NEBNext Ultra II RNA library Prep Kit |
NEB |
Cat# E7770 |
|
| Deposited data |
|
| Raw and analyzed data |
This paper |
GEO: GSE166480
|
| NCBI Gene Expression Omnibus database |
Tian et al., 2020 |
GEO: GSE136904
|
| Mouse reference genome NCBI build 38, mm10 |
Genome Reference Consortium |
https://www.ncbi.nlm.nih.gov/grc/mouse |
|
| Experimental models: cell lines |
|
| Mouse: 344SQ, 393P, 531LN1, 531LN2, 307P, 412P, and their transfected derivatives |
Gibbons et al., 2009 |
N/A |
| Mouse: 344SQ_RFP |
Padhye et al., 2019 |
N/A |
| Mouse: 344SQ_shCtL, 344SQ_shZEB1, 344SQ_mir206, 344SQ_mir148a |
Tan et al., 2017 |
N/A |
| Mouse: 393P_vec, 393P_ZEB1, 344SQ_miR-181 |
Tan et al., 2018 |
N/A |
| Mouse: 344SQ_miR-200 |
Ahn et al., 2012 |
N/A |
| Mouse: CAFS-GFP |
This paper |
N/A |
| Mouse: 393_RFP |
This paper |
N/A |
|
| Experimental models: organisms/strains |
|
| Mouse: KrasLA1/+, 129/SV |
The Jackson Laboratory |
N/A |
|
| Oligonucleotides |
|
| siRNA against murine DDR2 |
Sigma-Aldrich |
SASI_Mm01_00106702 |
| siRNA against murine DDR2 |
Sigma-Aldrich |
SASI_Mm01_00106703 |
| siRNA against murine DDR2 |
Sigma-Aldrich |
SASI_Mm01_00106704 |
| siRNA against murine Itih2 |
Sigma-Aldrich |
SASI_Mm01_00067716 |
| siRNA against murine Itih2 |
Sigma-Aldrich |
SASI_Mm01_00067717 |
| siRNA against murine Itih2 |
Sigma-Aldrich |
SASI_Mm01_00067718 |
| Universal siRNA negative control #2 |
Sigma-Aldrich |
N/A |
| DDR2_F: TCATCCTGTGGAGGCAGTTCTG |
Sigma-Aldrich |
N/A |
| DDR2_R: CTGTTCACTTGGTGATGAGGAGC |
Sigma-Aldrich |
N/A |
| RLP32_F: GGAGAAGGTTCAAGGGCCAG |
Sigma-Aldrich |
N/A |
| RLP32_R: TGCTC CCATAACCGATGTTTG |
Sigma-Aldrich |
N/A |
| Itih2_F: ACCAGGACACATCCTCTCAGCT |
Sigma-Aldrich |
N/A |
| Itih2_R: CAGAACCTCCGAAGTAGTTGTGG |
Sigma-Aldrich |
N/A |
| MATQ-seq primer mix |
Sheng et al., 2017 |
N/A |
|
| Recombinant DNA |
|
| pLVX-puro |
Clontech |
Cat# 632164 |
| EF-pLenti6.3-GFP |
Dr. Scott lab (BCM) |
N/A |
|
| Software and algorithms |
|
| ImageJ |
Schneider et al., 2012 |
https://imagej.nih.gov/ij/ |
| GraphPad Prism 7.03 |
GraphPad |
N/A |
| BD FACSDiva 6.1.3 software |
BD Biosciences |
N/A |
| NIS-Elements |
Nikon |
N/A |
| R Studio |
R studio |
https://www.r-project.org/ |
| GSEA 4.0.3 |
Subramanian et al., 2005 |
https://www.gsea-msigdb.org/gsea/index.jsp |
| MATLAB R2019a |
The MathWorks, Inc. |
https://www.mathworks.com/products/matlab.html |
| Cutadapt 1.18 |
Martin, 2011 |
https://github.com/marcelm/cutadapt/ |
| STAR 2.5.3a |
Dobin et al., 2013 |
https://github.com/alexdobin/STAR |
| Samtools 1.7 |
Li et al., 2009 |
https://github.com/samtools/ |
| htseq-count 0.10.0 |
Anders et al., 2015 |
https://pypi.org/project/HTSeq/ |
| seqtk 1.2-r94 |
Shen et al., 2016 |
https://github.com/lh3/seqtk |
| gencode.vM10.annotation.gtf |
N/A |
https://www.gencodegenes.org/mouse/release_M10.html |
| edgeR 3.26.8 |
Robinson et al., 2010 |
https://bioconductor.org/packages/release/bioc/html/edgeR.html |
|
| Other |
|
| Transwell Boyden chambers |
Thermo Scientific |
Cat# 141078 |
| Glass-bottom 35mm dishes |
Mattek |
Cat# P35G-1.5-14-C |
| Glass bottom 24-well plate |
Mattek |
Cat# P24G-1.5-13-F |
| Culture-insert 2-well, 35 mm plate |
Ibidi |
Cat# 81176 |
