| Antibodies |
| Mouse monoclonal anti-ΔNp63 (4A4) |
Santa Cruz |
sc-8431 |
| Rabbit polyclonal anti-Notch1 intracellular domain |
Abcam |
AB_306525 |
| Mouse monoclonal anti-ATPase, (Na(+) K(+)) alpha subunit, supernatant |
Developmental Studies Hybridoma Bank |
a5 |
| Rabbit polyclonal anti-GFP |
Thermo Fisher Scientific |
A11122 |
| Anti-Digoxigenin, Fab fragments |
Roche |
11214667001 |
| Alexa Fluor 488 goat anti-rabbit IgG (H+L), Superclonal™ Recombinant |
Thermo Fisher Scientific |
A27034 |
| Alexa Fluor 594 goat anti-mouse IgG (H+L) |
Thermo Fisher Scientific |
A11005 |
| Alexa Fluor 568 goat anti-mouse IgG (H+L) |
Thermo Fisher Scientific |
A11004 |
| Bacterial and Virus Strains |
| E. coli DH5α |
New England Biolabs |
C2987I |
| Chemicals, Peptides, and Recombinant Proteins |
| LY411575 |
Selleckchem |
S2714 |
| EnGen Lba Cas12a (Cpf1) |
NEB |
M0653T |
| FM1-43FX |
Thermo Fisher Scientific |
F35355 |
| Neomycin sulfate |
Sigma |
N6386 |
| EdU |
Carbosynth |
NE08701 |
| Alexa Fluor-594 Azide |
Thermo Fisher Scientific |
A10270 |
| DIG labeling mix |
Roche |
11277073910 |
| RNAse inhibitor |
Roche |
03335402001 |
| DNase I |
New England Biolabs |
M0303S |
| Proteinase K |
Roche |
03115828001 |
| NBT (4-Nitro blue tetrazolium chloride) |
Roche |
11383213001 |
| BCIP (5-bromo-4-chloro-3-indolyl-phosphate, 4-toluidine salt) |
Roche |
11383221001 |
| Transcription optimized 5x buffer |
Promega |
P1181 |
| DTT (100mM) |
Promega |
P1171 |
| T3 RNA polymerase |
Promega |
P2083 |
| DAPI |
Invitrogen |
D1306 |
| Trypsin-EDTA (0.25%), phenol red |
Thermo Fisher Scientific |
25200056 |
| Actinomycin D |
Sigma |
A1410 |
| DRAQ5™ Fluorescent Probe Solution (5 mM) |
Thermo Fisher Scientific |
62251 |
| Critical Commercial Assays |
| Hybridization Chain Reaction (HCR) v3.0 |
Molecular Instruments |
N/A |
| Chromium Next GEM Single Cell 3’ GEM, Library & Gel Bead Kit v3.1 |
10x Genomics |
120267 |
| Deposited Data |
| Sequencing data |
This paper |
GEO accession number GSE168695
|
| Experimental Models: Organisms/Strains |
| Zebrafish: TU-wildtype |
|
N/A |
| Tg(pou4f3:GAP-GFP)s356t |
Xiao et al., 2005 |
s356t; RRID: ZFIN_ZDB-GENO-100820-2 |
| Tg(-8.0cldnb:lynEGFP)zf106Tg |
Haas and Gilmour, 2006 |
zf106Tg; RRID: ZFIN_ZDB-ALT-060919-2 |
| Tg(tp1bglobin:EGFP)um13Tg |
Parsons et al., 2009 |
um13; RRID: ZDB-GENO-101201-5 |
| Tg(tp1bglobin:hmgb1-mCherry)jh11Tg |
Parsons et al., 2009 |
jh11Tg; RRID: ZDB-ALT-101006-1 |
| ET(krt4:EGFP)SqGw57a |
Kondrychyn et al., 2011 |
SqGw57a |
| Tg(ubi:creERt2)cz1702Tg |
Mosimann et al., 2011 |
cz1702Tg; RRID: ZDB-GENO-110121-2 |
| Tg(ubi:Zebrabow)a131Tg |
Pan et al., 2013 |
a131Tg; RRID: ZDB-ALT-130816-2 |
| TgBAC(cxcr4b:h2az2a-GFP,cryaa:DsRed) |
Kozlovskaja-Gumbrienė et al., 2017 |
sk84Tg; RRID: ZDB-TGCONSTRCT-180201-1 |
| Tg(krtt1c19e:lyn-Tomato)sq16Tg |
Lee et al., 2014 |
sq16Tg; RRID: ZDB-GENO-140424-5 |
| Tg(-8.0cldnb:H2A-mCherry)psi4Tg |
Romero-Carvajal et al., 2015 |
psi4Tg; RRID: ZDB-ALT-140623-3 |
| Tg(krtt1c19e:H2A-mCherry)pd309Tg |
Han et al., 2019 |
pd309Tg |
| Et(krt4:EGFP)sqet20ET |
Parinov et al., 2004 |
sqet20ET; RRID: ZFIN_ZDB-ALT-070628-20 |
| Tg(ubi:H2A-mCherry)psi18Tg |
This paper |
N/A |
| Tg(she:H2B-EGFP)psi59Tg |
This paper |
N/A |
| Tg(krtt1c19e:H2B-EGFP)psi63Tg |
This paper |
N/A |
| Tg(she:H2A-mCherry)psi57Tg |
This paper |
N/A |
| Tg(tp1bglobin:lox-mKate2-lox-SpvB)psi64Tg |
This paper |
N/A |
| Tg(krtt1c19e:cre-MYC)psi65Tg |
This paper |
N/A |
| Tg(Myo6:H2B-mScarlet-I)psi66Tg |
This paper |
N/A |
| Tg(Myo6b:Lck-mScarlet-I)psi67Tg |
This paper |
N/A |
| foxi3apsi68 |
This paper |
N/A |
| Oligonucleotides |
|
foxi3a gRNA 1: ATATGACAACCTACCGCAGA |
IDT |
N/A |
|
foxi3a gRNA 2: GGAGAATACGCAGGGCAGAC |
IDT |
N/A |
|
foxi3a F: CGATCAGAAAACGCCTGCAGACTGA |
IDT |
N/A |
|
foxi3a R1: GGGAGGTCTCACGAGTTTCATCAGATC |
IDT |
N/A |
|
foxi3a R2: GCAACGAATGGAATCAGAATGTACAGTGC |
IDT |
N/A |
| Recombinant DNA |
| pDEST-Myo6b:Lck-mScarlet-I |
This paper |
N/A |
| pDEST-tp1bglobin:lox-mKate2-lox-SpvB |
This paper |
N/A |
| pDEST-she:H2B-EGFP |
This paper |
N/A |
| pDEST-krtt1c19e:H2B-EGFP |
This paper |
N/A |
| pDEST-krtt1c19e:cre-MYC |
This paper |
N/A |
| pDEST-ubi:H2A-mCherry |
This paper |
N/A |
| pDEST-she:H2A-mCherry |
This paper |
N/A |
| pDEST-Myo6:H2B-mScarlet-I |
This paper |
N/A |
| Software and Algorithms |
| Fiji |
Schindelin et al., 2012 |
https://fiji.sc/ |
| Imaris |
Bitplane |
http://www.bitplane.com/imaris |
| Microsoft Excel |
Microsoft |
|
| GraphPad Prism |
GraphPad Software |
https://www.graphpad.com/scientific-software/prism/ |
| R version 4.0.2 |
R Core Team |
https://www.r-project.org/ |
| RStudio |
RStudio |
https://rstudio.com |
| ggplot2 (version: 3.2.1) |
Wickham et al., 2016 |
https://ggplot2.tidyverse.org/ |
| Cell Ranger 3.0.0 |
10x Genomics |
https://support.10xgenomics.com/single-cell-gene-expression/software/downloads/latest |
| Seurat v3.1.2 |
Butler et al., 2018; Stuart et al., 2019
|
https://satijalab.org/seurat/ |
