Table 3.
FISH probes used.
| Name | Sequence (5′-3′) | Target | Formamide Conc. [%] a | Fluorophore | NaCl Con. Washing Buffer [mM] | Reference |
|---|---|---|---|---|---|---|
| EUB338w b | gctgcctcccgtaggagt | Most bacteria | 10 | Cy3/Cy5 | 450 | [57] |
| EUB338IIw b | gcagccacccgtaggtgt | Planctomycetales | 10 | Cy3/Cy5 | 450 | [58] |
| EUB338IIIw b | gctgccacccgtaggtgt | Verrucomicrobiales | 10 | Cy3/Cy5 | 450 | [58] |
| ALF968 b | ggtaaggttctgcgcgtt | Alphaproteobacteria, except Rickettsiales | 40 | Cy3 | 56 | [59] |
| BET42aw b | gccttcccacttcgttt | Betaproteobacteria | 40 | 6FAM | 56 | [60] |
| GAM42aw b | gccttcccacatcgttt | Gammaproteobacteria | 40 | 6FAM | 56 | [60] |
| LGC354Aw b | tggaagattccctactgc | Firmicutes (low G + C Gram-positive bacteria) | 35 | Cy5 | 80 | [61] |
| LGC354Bw b | cggaagattccctactgc | Firmicutes (low G + C Gram-positive bacteria) | 35 | Cy5 | 80 | [61] |
| LGC354Cw b | ccgaagattccctactgc | Firmicutes (low G + C Gram-positive bacteria) | 35 | Cy5 | 80 | [61] |
| HGC69A | tatagttaccaccgccgt | Actinobacteria (high G + C Gram-positive bacteria) | 25 | Cy5 | 160 | [62] |
| R-FL615 | cactgcaatcgttgagcga | Bacteroidetes | 35 | Cy5 | 80 | [63] |
| PSE1284 | gatccggactacgatcggttt | Pseudomonadales | 30 | Cy5 | 220 | [64] |
| NONEUB | actcctacgggaggcagc | c | Cy3 | c | [65] |
a The indicated concentrations of formamide are intended for hybridizations at 46 °C. b Used together in equimolar concentration. c Used as a negative control at the same formamide/NaCl concentration for the positive FISH probe.