KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-LRRK2, Rabbit Monoclonal | Abcam | Cat# ab133474, RRID:AB_2713963 |
| Anti-Rab29, Rabbit Monoclonal | Abcam | Cat# ab256526 RRID:AB_2884877 |
| Anti-Rab29 (phospho T71), Rabbit Monoclonal | Abcam | Cat# ab241062 RRID:AB_2884878 |
| Anti-Rab10, Rabbit Monoclonal | Abcam | Cat# ab237703 RRID:AB_2884879 |
| Anti-Rab10 (phospho T73), Rabbit Monoclonal | Abcam | Cat# ab230261, RRID:AB_2811274 |
| Anti-Rab10 (phospho T73), Rabbit Monoclonal (for IF staining) | Abcam | Cat# ab241060, RRID:AB_2884876 |
| Anti-Rab8A, Rabbit Monoclonal | Cell Signaling | Cat# 6975, RRID:AB_10827742 |
| Anti-Rab8A (phospho T72), Rabbit Monoclonal | Abcam | Cat# ab230260, RRID:AB_2814988 |
| Anti-Rab12, Rabbit Polyclonal | Proteintech | Cat# 8843-1-AP, RRID:AB_10603469 |
| Anti-Rab12 (phospho S106), Rabbit Monoclonal | Abcam | Cat# ab256487, RRID:AB_2884880 |
| Anti-LC3B, Rabbit Polyclonal | Abcam | Cat# ab168831 |
| Anti-GM130, Mouse Monoclonal | BD Biosciences | Cat# 610823, RRID:AB_398142 |
| Anti-JIP3, Mouse Monoclonal | Santa Cruz | Cat# sc-46663, RRID:AB_627840 |
| Anti-JIP4/SPAG9, Rabbit Monoclonal | Cell Signaling | Cat# 5519, RRID:AB_10828724 |
| Anti-JIP4, Mouse Monoclonal | Santa Cruz | Cat# sc-271492, RRID:AB_10659098 |
| Anti-Kinesin Heavy Chain, Mouse Monoclonal | EMD millipore | Cat# MAB1614, RRID:AB_94284 |
| Anti-p150 [Glued], Mouse Monoclonal | BD Biosciences | Cat# 610474, RRID:AB_397846 |
| Anti-Arf6, Rabbit Polyclonal | Abcam | Cat# ab77581, RRID:AB_2058475 |
| Anti-Rabbit IgG-IRDye 800CW, Donkey Polyclonal | Li-COR Biosciences | Cat# 926-32213, RRID:AB_621848 |
| Anti-Rabbit IgG-IRDye 680RD, Donkey Polyclonal | Li-COR Biosciences | Cat# 926-68073, RRID:AB_10954442 |
| Anti-Mouse IgG-IRDye 800CW, Donkey Polyclonal | Li-COR Biosciences | Cat# 926-32212, RRID:AB_621847 |
| Anti-Mouse IgG Light Chain-AlexaFluor680, Goat Polyclonal | Jackson Immuno Research Labs | Cat# 115-625-174, RRID:AB_2338937 |
| Bacterial and Virus Strains | ||
| BacMam mEGFP-LC3 | Thermo Fisher | Cat# P36235 |
| NEB Turbo Competent E. coli | New England Biolabs | Cat# C2984 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| MLi-2 | Tocris | Cat# 5756 |
| DMSO | Sigma-Aldrich | Cat# D2650 |
| Janelia Fluor 646 HaloTag | Promega | Cat# GA1120 |
| PLL (mol wt 70,000 – 150,000) | Sigma-Aldrich | Cat# P1274 |
| HBSS (10x) | Thermo Fisher | Cat# 14185-052 |
| 1M HEPES | Thermo Fisher | Cat# 15630-080 |
| 2.5% Trypsin | Thermo Fisher | Cat# 15090-046 |
| Minimum essential medium (MEM) | Thermo Fisher | Cat# 11095-072 |
| Horse serum (heat inactivated) | Thermo Fisher | Cat# 16050-122 |
| Sodium pyruvate | Corning | Cat# 36017004 |
| D-Glucose solution 45% | Sigma-Aldrich | Cat# G8769 |
| GlutaMAX | Thermo Fisher | Cat# 35050061 |
| B27 Supplement | Thermo Fisher | Cat# 17504-044 |
| Neurobasal Medium | Thermo Fisher | Cat# 21103-049 |
| Penicillin-Streptomycin | Thermo Fisher | Cat# 15140-122 |
| AraC | Sigma-Aldrich | Cat# C6645 |
| Lipofectamine 2000 Transfection Reagent | Thermo Fisher | Cat# 11668019 |
| Matrigel Growth Factor Reduced | Corning | Cat# 354230 |
| Essential 8 Medium | Thermo Fisher | Cat# A1517001 |
| mTeSR Medium | Stemcell Technologies | Cat# 85850 |
| ReLeSR | Stemcell Technologies | Cat# 05872 |
| Accutase | Stemcell Technologies | Cat# 07920 |
| ROCK Inhibitor Y-27632 | Selleckchem | Cat# S1049 |
| Tet System Approved FBS | Takara | Cat# 631107 |
| DMEM/F-12, HEPES | Thermo Fisher | Cat# 11330032 |
| N2 Supplement | Thermo Fisher | Cat# 17502048 |
| Non-essential Amino Acids (NEAA) | Thermo Fisher | Cat# 11140050 |
| Doxycycline | Sigma-Aldrich | Cat# D9891 |
| Poly-L-Ornithine | Sigma-Aldrich | Cat# P3655 |
| BrainPhys Neuronal Medium | Stemcell Technologies | Cat# 05790 |
| Laminin | Corning | Cat# 354232 |
| BDNF | PeproTech | Cat# 450-02 |
| NT-3 | PeproTech | Cat# 450-03 |
| Lipofectamine Stem Transfection Reagent | Thermo Fisher | Cat# STEM00003 |
| Guanosine-50-[(ab)-methyleno]triphosphate, sodium salt (GMPCPP) | Jena Bioscience | NU-405 |
| AMP-PNP | Sigma-Aldrich | A2647 |
| Microcystin-LR | Sigma-Aldrich | 475815 |
| Halt Protease and Phosphatase Inhibitor Cocktail | Thermo Fisher | 78442 |
| Critical Commercial Assays | ||
| BCA Protein Assay Kit | Thermo Fisher | Cat# 23225 |
| Plasmid Maxi Kit | QIAGEN | Cat# 12163 |
| Experimental Models: Cell Lines | ||
| Human: NGN2 iPSCs | M. Ward (National Institutes of Health) [76] | N/A |
| Human: LRRK2-G2019S NGN2 iPSCs (heterozygous) | This paper | N/A |
| Human: LRRK2-WT NGN2 iPSCs | This paper | N/A |
| Mouse: LRRK2-G2019S knock-in MEFs | This paper | N/A |
| Experimental Models: Organisms/Strains | ||
| Mouse: LRRK2-G2019S knock-in | Taconic | Model #13940 |
| Mouse: C57BL/6NTac WT | Taconic | Model #B6 |
| Rat: hippocampal neuron cultures from embryonic day 18 rat brains (Sprague Dawley) | University of Pennsylvania Neuron Culture Service Center | N/A |
| Oligonucleotides | ||
| gRNA for LRRK2-G2019S knock-in: TGCTCAGTACTGCTGTAGAATGG |
This paper | N/A |
| LRRK2-G2019S ssDNA HDR template: TTTTCACACTGTATCCCAATGCTGCCATCATTGCAAAGATTGCTGACTACAGCATTGCGCAATATTGCTGCCGGATGGGGATAAAAACATCAGAGGGCACACCAGGTAGGTGATCAGGTCTGTC |
This paper | N/A |
| LRRK2-WT ssDNA HDR template: TTTTCACACTGTATCCCAATGCTGCCATCATTGCAAAGATTGCTGACTACGGCATTGCGCAATATTGCTGCCGGATGGGGATAAAAACATCAGAGGGCACACCAGGTAGGTGATCAGGTCTGTC |
This paper | N/A |
| Recombinant DNA | ||
| Plasmid: EGFP-LRRK2-WT | Modified from FLAG-LRRK2-WT (gift from W. Smith, Johns Hopkins) | N/A |
| Plasmid: EGFP-LRRK2-G2019S | Modified from FLAG-LRRK2-G2019S (gift from W. Smith, Johns Hopkins) | N/A |
| Plasmid: EGFP-LRRK2-G2019S-D1994N | Modified from FLAG-LRRK2-G2019S-D1994N (gift from W. Smith, Johns Hopkins) | N/A |
| Plasmid: mCherry-LC3B | Modified from EGFP-LC3 (gift from T. Yoshimori, Osaka University, Japan) | N/A |
| Plasmid: PGK EGFP-LC3B | Modified from PGK mCherry-LC3B (gift from Michael Ward, NIH) | N/A |
| Plasmid: mCherry-EGFP-LC3B | Gift from T. Johansen, University of Tromso, Norway | N/A |
| Plasmid: EGFP-Rab29 | Gift from D. Alessi (D. Alessi (University of Dundee, United Kingdom) | N/A |
| Plasmid: Halo-Rab29 | Modified from EGFP-Rab29 | N/A |
| Plasmid: EGFP-Rab5 | Gift from M. Zerial (Max Planck Institute, Dresden) | N/A |
| Plasmid: LAMP1-RFP | Gift from W. Mothes (Yale) | Addgene #1817 |
| Plasmid: SEP-LAMP1-RFP | Gift from J. Bonifacino (NIH) | N/A |
| Plasmid: EB3-mCherry | Gift from A. Akhmanova (Utrecht University) | N/A |
| Plasmid: Halo-JIP4 | This paper | Modified from MRC PPU #DU27651 |
| Software and Algorithms | ||
| FIJI | NIH, USA | https://imagej.net/Fiji |
| Kymograph Clear 2.0 (FIJI plugin) | [80] | https://sites.google.com/site/kymographanalysis/ |
| Prism 8 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| Matlab R2018b | MathWorks | https://www.mathworks.com/products/matlab.html |
| KymoSuite (custom Matlab script) | [79] | https://github.com/jnirschl/kinesin-3_guedes-dias_2018 |
| Volocity | PerkinElmer | https://www.perkinelmer.com |
| Adobe Illustrator 2021 | Adobe | https://www.adobe.com/products/illustrator.html |
| Other | ||
| 35 mm #1.5 glass bottom imaging dishes, 14 mm glass diameter | MatTeK | Cat# P35G-1.5-14-C |
| 35 mm #1.5 glass bottom imaging dishes, 20 mm glass diameter | MatTek | Cat# P35G-1.5-20-C |