Figure 2.

TNF inhibition affects immature myeloid cell development in vitro. Bone marrow cells were isolated from femurs of hTNFKI mice and cultured for 5 days in RPMI 1640 medium supplemented with L-Glutamine (2 mM), penicillin (100 U/ml), streptomycin (100 μg/ml), HEPES (10 mM), β-mercaptoethanol (50 μM), 10% FBS, GM-CSF (20 ng/ml) and IL-4 (10 ng/ml). Infliximab was added in the final concentration of 100 ng/ml. After 5 days in culture cells were stained with Fixable Viability Dye, CD11b (M1/70), Ly6C (HK1.4), Ly6G (RB6-8C5) and acquired with BD FACSCanto II flow cytometer. Data were analyzed using FlowJo software. (A) Representative FACS plots of Ly6G⁺Ly6C^low and Ly6G^-Ly6C^high cells gated on VD^-CD11b⁺ cells. (B) Frequencies of Ly6G⁺Ly6C^low and Ly6G^-Ly6C^high cells gated on VD^-CD11b⁺ cells. (C) Ly6G^-Ly6C^high cells were purified using Myeloid-Derived Suppressor Cell Isolation Kit (Miltenyi Biotec) according to the manufacturer’s protocol. RNA was isolated from purified cells using TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions. RNA (1 μg) was treated with DNase I and reverse transcribed to cDNA with M-MuLV reverse transcriptase (RevertAid first strand cDNA synthesis kit, Thermo Scientific). Real-time quantitative PCR was performed using qPCRmix-HS SYBR+LowROX (Evrogen) and the following primer set: Actb, Forward: CTCCTGAGCGCAAGTACTCTGTG, Reverse: TAAAACGCAGCTCAGTAACAGTCC, Bcl2, Forward: GAGTTCGGTGGGGTCATGTG, Reverse: TATAGTTCCACAAAGGCATCCCAG, Bcl2a1a, Forward: GGCAGAATGGAGGTTGGGAAG, Reverse: ATTCTCGTGGGAGCCAAGGT, Bcl2l1, Forward: AGAGAGGCAGGCGATGAGTT, Reverse: TCCACAAAAGTGTCCCAGCC. Reactions were run using the following program on the Applied Biosystems 7500: 95°C for 10 min, 40 cycles of 95°C for 15 sec, 61°C for 30 sec and 72°C for 20 sec. Each point in a diagram represents a single mouse; mean ± SEM. *P < 0,05; **P < 0,01. Two-tailed unpaired Student’s t-test was used.