Table 3.
Predicted splice site scores of human SMN1 and mouse Smn exons 5 and 7 using MaxEntScan. Nucleotides in CAPITALS indicate exon sequence, lower case nucleotides represent intronic sequences.
| Species | Exon | Splice Site | Splice Site Sequence | MES Score |
|---|---|---|---|---|
| Human | 5 | Acceptor Donor |
ctttgaaatattccttatag CCA CCAgtaagt |
5.44 9.09 |
| 7 | Acceptor Donor |
ttcctttattttccttacagGGT GGAgtaagt |
10.92 8.57 |
|
| Mouse | 5 | Acceptor Donor |
cttggaaatattctttatagCCA CCAgtaagt |
3.29 9.09 |
| 7 | Acceptor Donor |
tttatatgctctctttacagGGT GAAgtaagt |
11.13 9.82 |