Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
DNA sequence of the tested yeast-originating OST1 and the artificial pre-OST1-pro-α-factor secretion signal
| Signal peptide | DNA sequence 5` 3` |
|---|---|
| OST1 | atgaggcaggtttggttctcttggattgtgggattgttcctatgttttttcaacgtgtcttctgct |
| pre-OST1-pro-α-factor | atgaggcaggtttggttctcttggattgtgggattgttcctatgttttttcaacgtgtcttctgctgcccctgttaacactaccactgaagacgagactgctcaaattccagctgaagcagttatcggttactctgaccttgagggtgatttcgacgtcgctgttttgcctttctctgcttccattgctgctaaggaagagggtgtctctctcgagaagagagaggccgaagct |
