KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-Ebp1CT | rabbit, Abcam | ab35424; RRID:AB_732061 |
| anti-Ebp1NT | rabbit, Millipore | ABE43; RRID:AB_10616223 |
| anti-eEF2 | rabbit, Cell Signaling | 2332S; RRID:AB_10693546 |
| anti-Gapdh | mouse, Millipore | MAB374; RRID:AB_2107445 |
| anti-GFP | chicken, Abcam | ab13970; RRID:AB_300798 |
| anti-Map2 | chicken, Millipore | AB5543; RRID:AB_571049 |
| anti-Nestin | mouse, Millipore | MAB353; RRID:AB_94911 |
| anti-Rpl7 (uL30) | rabbit, Abcam | ab72550; RRID:AB_1270391 |
| anti-Rps5 (uS7) | mouse, Santa Cruz | sc-390935; RRID:AB_2713966 |
| Gold-conjugated-anti-rabbit IgG | goat, Nanoprobes | 2003; RRID:AB_2687591 |
| HRP-anti-rabbit-Light Chain | mouse, Dianova | 211-032-171; RRID:AB_2339149 |
| HRP-anti-mouse-Heavy Chain | goat, Millipore | 71045; RRID:AB_11211441 |
| 488-anti-chicken | donkey, Jackson ImmunoResearch | 703-545-155; RRID:AB_2340375 |
| 488-anti-rabbit | donkey, Jackson ImmunoResearch | 711-545-152; RRID:AB_2313584 |
| 594-anti-mouse | donkey, Jackson ImmunoResearch | 715-585-150; RRID:AB_2340854 |
| 647-anti-chicken | donkey, Jackson ImmunoResearch | 703-605-155; RRID:AB_2340379 |
| Recombinant DNA | ||
| Control siRNA (non-targeting) | Dharmacon | D-001810-10-05 |
| Homo sapiens siPa2g4 siRNA | Dharmacon | SMARTpool ON-TARGETplus #5036, #L008860-00-0005 |
| Luciferase reporter pSPUTK-luc+ | Rakwalska and Rospert, 2004 | |
| Mus musculus Pa2g4 cDNA | Source BioScience | IRAVp968A0190D |
| Mus musculus shPa2g4 shRNA | Sigma Mission | TRCN0000236756, RefSeq NM_011119 |
| Mus musculus siPa2g4 siRNA | Dharmacon | SMARTpool ON-TARGETplus #18813, #L-042883-01-0005 |
| pCAGIG (pCAG-IRES-GFP) | Ambrozkiewicz et al., 2018 | |
| pET-28a(+) | Novagen | 69864-3 |
| pSuper-Neo-GFP | OligoEngine | VEC-pBS-0006 |
| pSuper-Neo-GFP-sh-Scramble | Ambrozkiewicz et al., 2018 | |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Acetonitrile | CHEMSOLUTE | 2697 |
| Acetonitrile (Alkyne-agarose enrichment) | Sigma-Aldrich | 271004 |
| Acetylated Bovine Serum Albumin (BSA-c) | Aurion | 900.022 |
| Agarose | Sigma-Aldrich | A9539 |
| Alkyne-agarose beads | Click-Chemistry Tools | 1033 |
| Ammonium bicarbonate (ABC) | Sigma-Aldrich | 9830 |
| B27 | Thermo Fisher | 17504044 |
| Bovine serum albumin | Sigma-Aldrich | A3294 |
| Copper(II) sulfate pentahydrate | Sigma-Aldrich | 209198 |
| Cycloheximide | Sigma-Aldrich | C7698 |
| DAPI (Nuc Blue, Molecular Probes) | Invitrogen | R37606 |
| Dithiothreitol (DTT) | Sigma-Aldrich/Roche | DTT-RO |
| Dithiothreitol (DTT) (Alkyne agarose enrichment) | BioMol | 40010.25 |
| DMEM | GIBCO | 31966047 |
| DMEM - methionine free | Sigma-Aldrich | D0422 |
| DNase-I | Roche | 4716728001 |
| Ebp1 recombinant protein | mouse, this paper | |
| EcoRI restriction enzyme | New England Biolabs | R0101 |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma-Aldrich | E-5143 |
| Ethylene glycol bis(β-aminoethylether) tetraacetic acid (EGTA) | Roth | 3054 |
| Epoxy embedding medium Epon 812 | Sigma-Aldrich | 45345 |
| Ethanol | J.T. Baker | 8025 |
| Fetal Bovine Serum | GIBCO | 10270106 |
| Fetal Bovine Serum - dialyzed | PAN-Biotech | P30-2102 |
| Fluoromount-G | Southern Biotech | 0100-01 |
| Formic acid | Sigma-Aldrich | 33015 |
| Glutamax | Thermo Fisher | 35050-038 |
| Glutaraldehyde | Sigma-Aldrich | G5882 |
| HEPES | Sigma-Aldrich | 391338 |
| IGEPAL CA-630 | Sigma-Aldrich | I8896 |
| Iodoacetamide (IAA) | Sigma-Aldrich | I6125 |
| KCl | Roth | 6781.1 |
| L-Arginine:HCl (13C6, 99%; 15N4, 99%) (Arg-10) | Cambridge Isotope Labs | CNLM-539 |
| L-Arginine:HCl (13C6, 99%) (Arg-6) | Cambridge Isotope Labs | CLM-2265 |
| L-azidohomoalaine (AHA) | Anaspec | AS-63669 |
| L-Lysine:2HCl (13C6, 99%; 15N2, 99%) (Lys-8) | Cambridge Isotope Labs | CNLM-291 |
| L-Lysine:2HCl (4,4,5,5-D4, 96-98%) (Lys-4) | Cambridge Isotope Labs | DLM-2640 |
| Lead citrate | Fluka | GA10655 |
| Lipofectamine RNAiMAX Transfection Reagent | Thermo Fisher | 13778075 |
| Liquid ethane, grade 3.5 | Linde GmbH | |
| Lysyl endopeptidase (LysC) | Wako | 12505061 |
| Methanol | Merck Millipore | 1.06009.2511 |
| MgCl2 | Ambion | AM9530G |
| Nanogold silver enhancement | Nanoprobes | |
| Neurobasal medium | Thermo Fisher | 21103049 |
| Neurobasal custom medium (-met / -arg/ -lys) | GIBCO | 041-96642M |
| Normal goat serum | PAN-Biotech | P30-1002 |
| Osmium tetroxide (OsO4) | Polysciences | 0972A |
| Papain | Sigma-Aldrich | P4762 |
| Paraformaldehye (PFA) | Sigma-Aldrich | P6148 |
| Penicillin-Streptomycin | Thermo Fisher | 15140-122 |
| Phusion High-Fidelity DNA polymerase | Thermo Fischer | F-530XL |
| Phenylmethyl sulphonyl fluoride (PMSF) | Roth | 6367 |
| Poly-L-Lysine | Sigma-Aldrich | P1399 |
| Protease Inhibitor Cocktail Set III, EDTA-Free | Calbiochem/Sigma-Aldrich | 539134 |
| Protease Inhibitor cOmplete EDTA-free | Roche | 5056489001 |
| Rabbit reticulocyte lysate nuclease-treated | Promega | L4960 |
| ReproSil-Pur C18-AQ 3-μm resin | Dr. Maisch GmbH | r13.aq |
| RNasin Plus RNase inhibitor | Promega | N2615 |
| RNase-I | Thermo Fisher | EN0601 |
| SeeBlue Plus2 Prestained Protein Ladder | Thermo Fisher | LC5925 |
| SILAC-DMEM | PAN-Biotech | P04-02505 |
| Sodium borohydride (NaBH4) | Sigma-Aldrich | 452882 |
| Sodium deoxycholate | Sigma-Aldrich | D6750 |
| Sodium dodecyl sulfate (SDS) | Roth | 2326.1 |
| Sodium L-ascorbate | Sigma-Aldrich | A7631 |
| Spermidine●3HCl | Sigma-Aldrich | S2501 |
| Spermine●4HCl | Sigma-Aldrich | S2876 |
| Sucrose | Sigma-Aldrich | S0389 |
| SUPERase-In RNase inhibitor | ThermoFisher | AM2694 |
| T4 PNK | New England Biolabs | M0201S |
| Tris-HCl | Roth | 9090.3 |
| Tris(3-hydroxypropyltriazolylmethyl) amine (THPTA) | Sigma-Aldrich | 762342 |
| Triton X-100 | Sigma-Aldrich | T8787 |
| TRIzol-LS | Invitrogen | 10296010 |
| Trypsin | Promega | V511A |
| TurboDNase | Thermo Fisher | AM2238 |
| Tween | Sigma-Aldrich | P9416 |
| Uranyl acetate | Merck | 1.08473.0100 |
| Urea | Sigma-Aldrich | 51459 |
| Vectashield Antifade Mounting Medium | Vector Laboratories | H-1000 |
| Critical Commercial Assays | ||
| Amersham ECL Prime | GE Healthcare | RPN2232 |
| Dynabeads | Life Technologies | 10008D |
| NEBNext Ultra Directional RNA Library Prep Kit for Illumina | New England BioLabs | E7420L |
| NEXTflex Small RNA-seq Kit v3 | Bio Scientific | NOVA-5132-06 |
| RNA Clean & Concentrator-25 Kit | Zymo Research | R1017 |
| RiboZero Kit | Illumina | 20037135 |
| TruSeq Stranded mRNA Kit | Illumina | 20020594 |
| Zymoclean Gel DNA Recovery Kit | Zymo Research | D4007/D4008 |
| Deposited Data | ||
| Neocortex total lysate, 80S, polysome mass spectrometry | this paper | ProteomeXchange PXD014841 |
| Neuro2a pSILAC/AHA mass spectrometry | this paper | ProteomeXchange PXD014740 |
| Neocortex total lysate RNA sequencing | this paper | NIH GEO: GSE157425 |
| Cryo-EM maps of the P0 neocortical ribosome | this paper | Worldwide Protein Data Bank EMD-10321 |
| Atomic model of the P0 neocortical 60S●Ebp1 complex | this paper | Worldwide Protein Data Bank PDB: 6SWA |
| Ebp1-selective Ribosome Profiling | this paper | NIH GEO: GSE157425 |
| Ebp1-knockdown Ribosome Profiling | this paper | NIH GEO: GSE157425 |
| Ebp1-knockdown RNaseq | this paper | NIH GEO: GSE157425 |
| Experimental Models: Cell Lines | ||
| Neuro2a | Thermo Fisher | RRID: CVCL_0470 |
| Experimental Models: Organisms/Strains | ||
| CD1 WT mice | Charles River | N/A |
| Nex:Cre;Ai9 mice | Turko et al., 2019 | N/A |
| NMRI WT mice | Charles River and Janvier Labs | N/A |
| Software and Algorithms | ||
| Andromeda | Cox et al., 2011 | N/A |
| APBS | Jurrus et al., 2018 | N/A |
| CCP4Interface CONTACT | Potterton et al., 2003 | N/A |
| CLUSTAL Omega MSA (1.2.4) | Sievers et al., 2011 | https://www.ebi.ac.uk/Tools/msa/clustalo/ |
| COOT | Emsley and Cowtan, 2004 | N/A |
| CTFfind4 | Mindell and Grigorieff, 2003 | N/A |
| DAVID | Huang et al., 2009 | N/A |
| EMAN2 | Tang et al., 2007 | N/A |
| EPU | FEI Company | N/A |
| ERRASER | Chou et al., 2013 | N/A |
| FIJI | Schindelin et al., 2012 | https://fiji.sc/ |
| GraphPad Prism 7 | GraphPad Software Inc | https://www.graphpad.com/ |
| IBAQ | Schwanhäusser et al., 2011 | N/A |
| Illustrator | Adobe Creative Cloud | N/A |
| Image stitching plugin (FIJI) | Preibisch et al., 2009 | N/A |
| Leginon | Carragher et al., 2000; Suloway et al., 2005 | N/A |
| LFQ | Cox et al., 2014 | N/A |
| MaxQuant | Cox and Mann, 2008 | N/A |
| MolProbity | Chen et al., 2010 | N/A |
| Morpheus | https://software.broadinstitute.org/morpheus | N/A |
| MotionCor2 | Zheng et al., 2017 | N/A |
| Neurite Tracer plugin (FIJI) | Longair et al., 2011 | N/A |
| Perseus | Tyanova et al., 2016 | N/A |
| PHENIX | Adams et al., 2010 | N/A |
| Photoshop | Adobe Creative Cloud | N/A |
| Plastid CS | Dunn and Weissman, 2016 | N/A |
| RiboseQC v1.1 | https://github.com/ohlerlab/RiboseQC | N/A |
| Sholl analysis plugin (FIJI) | Ferreira et al., 2014 | N/A |
| SPHIRE/SPARX | Moriya et al., 2017 | N/A |
| SPIDER | Frank et al., 1996 | N/A |
| STAR | Dobin et al., 2013 | N/A |
| TopHat2 | Kim et al., 2013 | N/A |
| UCSF Chimera | Pettersen et al., 2004 | N/A |
| UCSF ChimeraX | Goddard et al., 2018 | N/A |
| Primers | ||
| Ebp1-His forward (recombinant protein) | Eurofins | 5′AATTCCATGGGCCACCATCACCATCA CCATTCGGGCGAGGACGAGCAAC3′ |
| Ebp1-His reverse (recombinant protein) | Eurofins | 5′TTAAGGATCCTTAGTCCCCAGCTTCA TTTTCTTC3′ |
| Ebp1-HA forward (overexpression plasmid) | Eurofins | 5′gtctcatcattttggcaaagATGTACCCATA CGATGTTCCAGATTACGCTTCGGG CGAAGACGAG3′ |
| Ebp1-HA reverse (overexpression plasmid) | Eurofins | 5′cggccgcgatatcctcgaggTCAGTCCCC AGCTCCATTC3′ |