Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (M. musculus) | Casr | GenBank | Casr | |
| Strain, strain background (M. musculus) | Mouse wild-type strain C57BL/6J × 129×1 | The Jackson Laboratory | RRID:MGI:5652742 | |
| Genetic reagent, strain background (M. musculus) | Mouse expressing Nestin-cre mutation | The Jackson Laboratory as used in Sun et al., 2018 | Stock No. 003771 | C57/BL6J and 129S4 background strain |
| Genetic reagent, strain background (M. musculus) | Mouse with Lox mutation to delete exon 7 of Casr | Laboratory of Dr. Wenhan Chang, UCSF (Chang et al., 2008) |
Casrfl/fl | C57/BL6J and 129S4 background strain |
| Sequence-based reagent | Casr | Applied Biosystems | Mm00443377_m1 | Quantitative PCR Mouse probe set |
| Sequence-based reagent | Actb | Applied Biosystems | Mm04394036_g1 | Quantitative PCR Mouse probe set |
| Sequence-based reagent | Nes-Cre1 primer | IDT | GCAAAACAGGCTCTAGCGTTCG | |
| Sequence-based reagent | Nes-Cre2 primer | IDT | CTGTTTCACTATCCAGGTTACGG | |
| Sequence-based reagent | P3U primer | IDT | TGTGACGGAAAACATACTGC | |
| Sequence-based reagent | Lox R primer | IDT | GCGTTTTTAGAGGGAAGCAG |