KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| AAT | R&D | Cat# AF1268; RRID:AB_354707 |
| Albumin | Bethyl | Cat# A80–229A, RRID:AB_67018 |
| CD146 | R&D | Cat# AF932, RRID:AB_355721 |
| CD31 | Cell Signaling Technologies | Cat# 3528, RRID:AB_2160882 |
| CD31 | Cell Signaling Technologies | Cat# 77699, RRID:AB_2722705 |
| CD34 | Abcam | Cat# ab81289, RRID:AB_1640331 |
| CDX2 | BioGenex | Cat# AM392, RRID:AB_2650531 |
| CEBPA | R&D | Cat# AF7094, RRID:AB_10973004 |
| CK18 | Santa Cruz Biotechonology | Cat# sc-32329, RRID:AB_627849 |
| Desmin | Santa Cruz Biotechonology | Cat# sc-7559, RRID:AB_639081 |
| Desmin | Santa Cruz Biotechonology | Cat# sc-23879, RRID:AB_627416 |
| E-Cadherin | Cell Signaling Technologies | Cat# 3195, RRID:AB_2291471 |
| EPCAM | Cell Signaling Technologies | Cat# 36746, RRID:AB_2799105 |
| ERG | Abcam | Cat# ab92513, RRID:AB_2630401 |
| FOXA2 | R&D | Cat# AF2400, RRID:AB_2294104 |
| GFP | Abcam | Cat# ab13970; RRID:AB_300798 |
| HNF4A | Cell Signaling Technologies | Cat# 3113; RRID:AB_2295208 |
| NANOG | R&D | Cat# AF1997; RRID:AB_355097 |
| NANOG | Cell Signaling Technologies | Cat# 3580; RRID:AB_2150399 |
| Nestin | Santa Cruz Biotechonology | Cat# sc-23927; RRID:AB_627994 |
| SOX17 | R&D | Cat# AF1924; RRID:AB_355060 |
| T/Brachyury | R&D | Cat# AF2085; RRID:AB_2200235 |
| AF-488 anti-chicken | Jackson Immunoresearch Laboratories | Cat# 703–545-155; RRID:AB_2340375 |
| AF-594 anti-chicken | Jackson Immunoresearch Laboratories | Cat# 703–585-155; RRID:AB_2340377 |
| AF-488 anti-goat | Thermo Fisher | Cat# A-11055; RRID:AB_2534102 |
| AF-594 anti-goat | Thermo Fisher | Cat# A-11058; RRID:AB_2534105 |
| AF-647 anti-goat | Thermo Fisher | Cat# A-21447; RRID:AB_141844 |
| AF-488 anti-rabbit | Thermo Fisher | Cat# A-21206; RRID:AB_2535792 |
| AF-594 anti-rabbit | Jackson Immunoresearch Laboratories | Cat# 711–585-152; RRID:AB_2340621 |
| AF-647 anti-rabbit | Thermo Fisher | Cat# A-31573; RRID:AB_2536183 |
| AF-488 anti-mouse | Thermo Fisher | Cat# A-21202; RRID:AB_141607 |
| AF-594 anti-mouse | Jackson Immunoresearch Laboratories | Cat# 715–585-151; RRID:AB_2340855 |
| AF-647 anti-mouse | Thermo Fisher | Cat# A-31571; RRID:AB_162542 |
| AF-594 anti-Sheep | Thermo Fisher | Cat# A-11016; RRID:AB_2534083 |
| AF-647 anti-Sheep | Thermo Fisher | Cat# A21448; RRID:AB_1500712 |
| APC-CD34 | Miltenyi | Cat# 130–090-954, RRID:AB_244349 |
| PE-CD146 | Miltenyi | Cat# 130–097-939, RRID:AB_2660768 |
|
Bacterial and Virus Strains | ||
| NEB 5 alpha competent E. coli | New England Biolabs | Cat# C2987H |
|
Biological Samples | ||
| Human Adult Liver Total RNA | Cell Applications, Inc | Cat# 1H21–50 |
|
Chemicals; Peptides; and Recombinant Proteins | ||
| Axitinib | Cell Signaling Technology | Cat# 12961S |
| Phosphate buffered saline | Corning | Cal# 21–040-CV |
| Polybrene | Millipore-Sigma | Cat# TR-1003-G |
| Thawing/Plating Cocktail A | Thermo Fisher Scientific | Cat# CM3000 |
| Cell Maintenance Cocktail B | Thermo Fisher Scientific | Cat# CM4000 |
| Rat tail collagen 1 | Thermo Fisher Scientific | Cat# A1048301 |
| GW4064 | Sigma Aldrich | Cat# G5172–5MG |
| Chenodeoxycholic acid | Cayman Chemical | Cat# 10011286 |
| Human recombinant FGF19 | Peprotech | Cat# 100–32 |
| human recombinant TGFβ1 | Peprotech | Cat# 100–21 |
| Human recombinant HGF | Peprotech | Cat# 100–39H |
| Human recombinant VEGF-165 | Peprotech | Cat# 100–20 |
| Dimethylsulfoxide | Sigma Aldrich | Cal# D2650–100ML |
| TRIzol Reagent | Thermo Fisher Scientific | Cat# 15596018 |
| Y-27632 Dihydrochloride | Stem Cell Technologies | Cat# 72305 |
| Puromycin Dihydrochloride | Sigma Aldrich | Cat# P8833 |
| Doxycycline hyclate | Sigma Aldrich | Cat# D9891 |
| Chloroform | Sigma Aldrich | Cat# 288306 |
| DMEM | Gibco | Cat# 11960069 |
| DMEM/F12 | Gibco | Cat# 11320082 |
| Williams E Medium | Thermo Fisher Scientific | Cat# A1217601 |
| mTeSR 1 | Stem Cell Technologies | Cat# 85850 |
| mFresR | Stem Cell Technologies | Cat# 05855 |
| STEMdiff APEL | Stem Cell Technologies | Cat# 28995 |
| Accutase | Stem Cell Technologies | Cat# 07922 |
| hESC qualified matrigel | Corning | Cat# 354277 |
| GFR, LDEV free matrigel | Corning | Cat# 354230 |
| Lipofectamine 3000 Transfection Reagent | Thermo Fisher Scientific | Cat# L3000001 |
| Super PiggyBac Transposase Expression Vector | System Biosciences | Cat# PB210PA-1 |
| RNeasy Plus Mini Kit | QIAGEN | Cat# 74134 |
| AllPrep DNA/RNA Mini Kit | QIAGEN | Cat# 80204 |
| SYBR green power up | Thermo Fisher Scientific | Cat# A25742 |
| Normal donkey serum | Jackson Immunoresearch Laboratories | Cat# 017–000-001 |
| Prolong Diamond Antifade | Thermo Fisher Scientific | Cat# P36970 |
| Xylenes | Fisher Chemical | Cat# X3S-4 |
| Anhydrous Ethanol | Fisher Chemical | Cat# A405P-4 |
| DAPI | Thermo Fisher Scientific | Cat# 62248 |
| Heocsht 33342 | Thermo Fisher Scientific | Cat# H3570 |
| Indocyanine Green | Sigma | Cat# 21980–100MG-F |
| Oil Red O | Sigma | Cat# O1391–250ML |
| Cytodex3 Microcarrier Beads | Sigma | Cat# C3275–10G |
| Anti-TRA-1–60 MicroBeads, human | Miltenyi Biotec | Cat# 130–100-832 |
| Anti-CD34 MicroBeads, human | Miltenyi Biotec | Cat# 130–046-702 |
| Anti-CD146 MicroBeads, human | Miltenyi Biotec | Cat# 130–093-596 |
| Nitisinone (NTBC) | Sigma | Cat# PHR1731–1G |
| Ganciclovir Sodium Salt | Santa Cruz Biotechnology | Cat# sc-394139B |
|
Critical Commercial Assays | ||
| Bethyl Albumin ELISA KIT | Bethyl | Cat# E80–129 |
| SERPINA1 (AAT) ELISA | Genway Biotech | Cat# GWB-1F2730 |
| Fibrinogen ELISA | Genway Biotech | Cat# GWB-C5E724 |
| C3 ELISA | Immunology Consultants Laboratory | Cat# E-80C3 |
| ANGPTL3 ELISA | RayBiotech | Cat# ELH-ANGPTL3–1 |
| Periodic Acid-Schiff (PAS) Kit | Millipore-Sigma | Cat# 395B-1KT |
| Total bile acid | Cell Biolabs | Cat# STA-631 |
| Urea assay | Bioassay Systems | Cat# DIUR-100 |
| qPCR Lentivirus titration kit | Applied Biological Materials | Cat# LV900 |
| CYP2C19 P450-Glo™ assay | Promega | Cat# V8881 |
| CYP3A4 P450-Glo™ Assay | Promega | Cat# V9001 |
|
Deposited Data | ||
| Bulk RNA sequencing of FeLO, engineered FeLO conditions, DesLO, and Liver | This paper | GEO Accession GSE159491 |
| Day 2, 6 liver bud, cryopreserved human hepatocytes, and whole liver RNA sequencing data | Asai et al., 2017 | GEO Accession GSE85223: GSM2262397, GSM2262398, GSM2262403, GSM2262404, GSM2262407, and GSM2262406 |
| FeLO and DesLO day 17 single cell RNA sequencing | This paper | GEO Accession GSE159491 |
| iPSC, FeLO, and DesLO ATACseq data | This paper | GEO Accession GSE159491 |
| Human liver organoids in differentiation medium RNA sequencing data | Akbari et al., 2019 | GEO Accession GSE130075: GSM3731529 and GSM3731530 |
| Human liver organoids D25 | Ouchi et al., 2019 | GEO Accession GSE130075: GSM3731529 and GSM3731530 |
| Fibroblast, transdifferentiated hepatocytes, and freshly isolated hepatocytes | Du et al., 2014 | GEO Accession GSE54066: GSM1306654 and GSM1306653 |
| Adult human liver single cell RNA sequencing | MacParland et al., 2018 | GEO Accession GSE115469 |
|
Experimental Models: Cell Lines | ||
| HEK293FT | Thermo Fisher Scientific | Catalog# R70007 |
| PGP1 rttA3 TRE GATA6–2A-EGFP | This paper | N/A |
| Primary Human Hepatocytes | MGH Cell Resource Core | lot# HH-083 |
| Primary Human Hepatocytes | Lonza | Catalog# HUCPG; lot# HUM17299A, lot# HUM180851 |
| Cellartis Enhanced hiPS-HEP v2 | Takara Bio Inc | Catalog# Y10133, Y10134 |
| iCell Hepatocytes | Stem Cell Technologies | Catalog# R1104 |
|
Experimental Models: Organisms/Strains | ||
| Mouse: TK-NOG, NOD.Cg-Prkdcscid Il2rgtm1Sug Tg(Alb-TK) 7–2/ShiJic | Taconic Biosciences | Cat# 12907-M |
| Mouse: FRG® KO on NOD | Yecuris Corporation | Cat# 10–0008 |
|
Oligonucleotides | ||
| CYP3A4 sgRNA Target Sequence 1: ACTCAAAGGAGGTCAGTGAG | This paper | N/A |
| CYP3A4 sgRNA Target Sequence 2: TGATTCTTTGCCAACTTCCA | This paper | N/A |
| Primers for qPCR | This paper | See Table S1 |
|
Recombinant DNA | ||
| psPax2 | Trono Lab Packaging and Envelope Plasmids (Unpublished) | Addgene Plasmid# 12260 |
| pCMV-VSV-G | Stewart et al., 2003 | Addgene Plasmid# 8454 |
| MS2-P65-HSF1-GFP | Konermann et al., 2015 | Addgene Plasmid# 61423 |
| U6-sgRNA-MS2 | Konermann et al., 2015 | Addgene Plasmid# 61424 |
| Cas9M4-VP64 | Mali et al., 2013 | Addgene Plasmid# 47319 |
| pENTR_L1_hGATA6–2A-EGFP_L2 | Guye et al., 2016 | N/A |
| PB-TAG-ERP2 | Kim et al., 2016 | Addgene Plasmid# 80479 |
| PROX1 transcript variant 2 cDNA | Origene | Cat# RC200081 |
| ATF5 transcript variant 1 cDNA | Genecopoeia | Cat# F0925 |
| CREB3L3 complete CDS cDNA | DNASU Plasmid Repository | Clone ID# HsCD00080068 |
| MLXIPL transcript variant 1 cDNA | DNASU Plasmid Repository | Clone ID# HsCD00820703 |
| Promoter: AAT Sequence: AGGTATCTTGC TACCAGTGGAACAGCCACTAAGGATTC TGCAGTGAGAGCAGAGGGCCAGCTAAG TGGTACTCTCCCAGAGACTGTCTGAC TCACGCCACCCCCTCCACCTTGG ACACAGGACGCTGTGGTTTCTGAGC CAGGTACAATGACTCCTTTCGGTAAG TGCAGTGGAAGCTGTACACTGCCCAG GCAAAGCGTCCGGGCAGCGTAGGC GGGCGACTCAGATCCCAGCCAGTGGA CTTAGCCCCTGTTTGCTCCTCCGATAA CTGGGGTGACCTTGGTTAATATTCA CCAGCAGCCTCCCCCGTTGCCCCTCT GGATCCACTGCTTAAATACGGACG AGGACAGGGCCCTGTCTCCTCAGC TTCAGGCACCACCACTGACCTGG GACAGTGAATCGTAAGTGCTT |
This paper | N/A |
|
Software and Algorithms | ||
| CellNet | P. Cahan Lab | https://github.com/pcahan1/CellNet |
| SingleCellNet | P. Cahan Lab | https://github.com/pcahan1/singleCellNet/ |
| R version 3.6.2 | The Comprehensive R Archive Network | https://cran.r-project.org/ |
| R Studio version 1.2.5033 | RStudio Inc. | https://rstudio.com/ |
| Cell Ranger | 10x Genomics | https://www.10xgenomics.com/ |
| Graphpad Prism 8 | Graphpad Software Inc. | https://www.graphpad.com/ |
| FlowJo | Becton, Dickson and Co. | https://www.flowjo.com/ |
| IGV (version 2.7.2) | Broad Institute | https://software.broadinstitute.org/software/igv/ |
| Angiotool (version 0.6a) | NIH National Cancer Institute Center for Cancer Research | https://ccrod.cancer.gov/confluence/display/ROB2/Downloads |
| ImageJ (version 1.48v) | NIH | https://imagej.nih.gov/ij/ |
| Enrichr | A. Ma’ayan Lab | https://amp.pharm.mssm.edu/Enrichr/ |
| Seurat 3 (version 3.6.2) | R. Satija Lab | https://satijalab.org/seurat/ |