Skip to main content
. 2021 May 25;30(11):578–586. doi: 10.1089/scd.2021.0013

Table 1.

Quantitative Polymerase Chain Reaction Breakpoint Detection Primer Sets and Probes [15]

Gene (location) accession no. Primer sequences (forward and reverse) UPL probe no.
RELL1 (4p14) NC_000004.12 tgcttgctcagaaggagctt tgggttcaggaacagagaca 12
DEFB115 (20q11.21) 31,257,664 NM_001037730.1 tcagcctgaacattctggtaaa cacttgtcttttccccaaactc 14
REM1 (20q11.21) 31,475,272 NM_014012.5 ccccttttctcactccacaa tctgcagggggagaagtaca 46
TPX2 (20q11.21) 31,739,101 NM_012112.4 cccccaaatcaggcctac ttaaagcaaaatccaggagtcaa 35
MYLK2 (20q11.21) 31,819,375 NC_000020.11 ggtcaggagaacccagagtg gtctcccagggcacttcag 16
XKR7 (20q11.21) 31,968,002 NM_033118.3 gtgtcttaccggggtcctatc gcctggaaggtgtgcagta 3
TM9SF4 (20q11.21) 32,109,506 NM_014742.3 taatggagccaatgccagta caaaaccagtttctgtgccttt 45
ASXL1 (20q11.21) 32,358,062 NM_015338.5 gagtgtcactgtggatgggtag ctggcatatggaaccctcac 13

UPL, Universal probe library.