Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological samples (Arabidopsis thaliana) | MAGIC lines | NASC | NASC ID: N782242 | PMID:19593375 |
| Biological samples (Arabidopsis thaliana) | MAGIC parental accessions | NASC | IDs of individual parental accessions: http://arabidopsis.info/CollectionInfo?id=112 |
PMID:19593375 |
| Biological samples (Arabidopsis thaliana) | Spanish accessions | NASC | PMID:26991665 | |
| Biological sample (Arabidopsis thaliana) | cyp707a1-1 | PMID:16543410 | Eiji Nambara, University of Toronto | |
| Biological sample (Arabidopsis thaliana) | cyp707a1-1 cyp707a2-1 | PMID:16543410 | Eiji Nambara, University of Toronto | |
| Biological sample (Arabidopsis thaliana) | ga3ox1-3 | NASC | NASC ID: N6943 | PMID:16460513 |
| Biological sample (Arabidopsis thaliana) | ga3ox1-3 ga3ox2-1 | NASC | NASC ID: N6944 | PMID:16460513 |
| Biological sample (Arabidopsis thaliana) |
dog1-3 (Col-0) (SALK 000867) |
NASC | NASC ID: N500867 | PMID:17065317 |
| Biological sample (Arabidopsis thaliana) |
anac060
(SALK 012554C) |
NASC | NASC ID: N665285 | PMID:24625790 |
| Biological sample (Arabidopsis thaliana) | ahg1-5 | PMID:28706187 | Guillaume Née, University of Münster | |
| Biological sample (Arabidopsis thaliana) |
dog1 (No-0) (dog1 mutant in No-0 background) |
RIKEN | BRC number: pst21966 Line number: 15-3980-1 |
|
| Sequence-based reagent | DOG1N_F | This paper | PCR primers | GAAATCCGCTCCTTGTACCG See Supplementary file 4 |
| Sequence-based reagent | DOG1N_R | This paper | PCR primers | GCATCCCTGAGCTCAAACAA See Supplementary file 4 |
| Sequence-based reagent | Ds5-2a | PMID:14996221 | PCR primers | TCCGTTCCGTTTTCGTTTTTTAC See Supplementary file 4 |
| Sequence-based reagent | DOG1-3 F | This paper | PCR primers | TTCCAGGAACGTTGTCGTATC See Supplementary file 4 |
| Sequence-based reagent | DOG1-3 R | This paper | PCR primers | AGTTTGTGACCCACACAAAGC See Supplementary file 4 |
| Sequence-based reagent | LBb1.3 | http://signal.salk.edu/tdnaprimers.2.html | PCR primers | ATTTTGCCGATTTCGAAC See Supplementary file 4 |
| Sequence-based reagent | ANAC060 F | This paper | PCR primers | TGGACTCTGTTTGAAGCCTTG See Supplementary file 4 |
| Sequence-based reagent | ANAC060 R | This paper | PCR primers | TATGCCTGTCCTGATTTGCTC See Supplementary file 4 |
| Sequence-based reagent | AHG1 LP | PMID:28706187 | PCR primers | ACCGACACGTGTTCTGTCTTC See Supplementary file 4 |
| Sequence-based reagent | AHG1 RP | PMID:28706187 | PCR primers | CTAAAACTCGACCACCAGCTG See Supplementary file 4 |
| Chemical compound, drug | Gibberellin A4 | Sigma Aldrich | G7276 | |
| Chemical compound, drug | Abscisic acid | Sigma Aldrich | A1049 | |
| Commercial assay, kit | NEB Next Ultra DNA Library Prep Kit | New England BioLabs | E7370L | |
| Software, algorithm | Organism | PMID:15961462 | https://gitlab.com/slcu/teamHJ/Organism | |
| Software, algorithm | R | R Foundation for Statistical Computing | https://www.R-project.org/ | |
| Software, algorithm | Python | Python Software Foundation | Version: Python 2.7 https://www.python.org/download/releases/2.7/ |
|
| Software, algorithm | Data analysis and modelling scripts | This paper | https://gitlab.com/slcu/teamJL/abley_formosa_etal_2020 ; Abley et al., 2021 copy archived at swh:1:rev:0a97b841e58b128c174d93fc759b28f1df2966a2 |