Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in the RT-qPCR analysis.
| Gene | Genbank | Primer sequences (5′-3′) | Size (bp) |
|---|---|---|---|
| accession | |||
| Pig GAPDH | NM_001206359.1 | CCAGGGCTGCTTTTAACTCTG | 104 |
| GTGGGTGGAATCATACTGGAACAT | |||
| Pig ANGPTL4 | NM_001038644.1 | GACTGCCAAGAGCTGTTTGAAGA | 126 |
| CTGAATTACAGTCCAGCCTCCAT |
