Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | Human kinome cDNA | Center for Cancer Systems Biology of Harvard University | hORFeome v3.1 | |
| Gene (Homo sapiens) | Human kinome cDNA | Thermo Fisher | Ultimate ORF Clone LITE Collection | |
| Cell line (Homo sapiens) | HeLa | ATCC | Cat# CCL-2, RRID:CVCL_0030 | |
| Cell line (Homo sapiens) | HEK293T | ATCC | Cat# CRL-11268, RRID:CVCL_1926 | |
| Cell line (Homo sapiens) | A375 | ATCC | Cat# CRL-1619, RRID:CVCL_0132 | |
| Cell line (Homo sapiens) | DU 145 | ATCC | Cat# HTB-81, RRID:CVCL_0105 | |
| Cell line (Homo sapiens) | MCF10A | ATCC | Cat# CRL-10317, RRID:CVCL_0598 | |
| Cell line (Homo sapiens) | Caki-1 | Liping Xie (Zhejiang University) | ||
| Cell line (Cercopithecus aethiops) | COS-7 | ATCC | Cat# CRL-1651, RRID:CVCL_0224 | |
| Transfected construct (Homo sapiens) | siNT | This paper | Control siRNA target sequence: UUCUCCGAACGUGUCA CGU |
|
| Transfected construct (Homo sapiens) | siMOK#1 | This paper | siRNA target sequence: CCUCUUUCCUGGAGUA AAU |
|
| Transfected construct (Homo sapiens) | siMOK#2 | This paper | siRNA target sequence: AGUCGAGAGCUAUGAA UUU |
|
| Transfected construct (Homo sapiens) | shNT | This paper | Control shRNA target sequence: CCTAAGGTTAAGTCGCCCTCG | |
| Transfected construct (Homo sapiens) | sh-TOM20 | This paper | shRNA target sequence: GGCGTAGACCATCTGACAAAT | |
| Transfected construct (Homo sapiens) | sh-TOM70 | This paper | shRNA target sequence: GCATGCTGTTAGCCGATAAAG |
|
| Transfected construct (Homo sapiens) | sh-TIM17A | This paper | shRNA target sequence: GCTGGTATCTTGTTGACAAGA |
|
| Transfected construct (Homo sapiens) | sh-TIM50 | This paper | shRNA target sequence: CCTCAAGACCATTGCACTGAA |
|
| Transfected construct (Homo sapiens) | sh-TIM23 | This paper | shRNA target sequence: CCAGCCTCTATGCACTATATA |
|
| Transfected construct (Homo sapiens) | sh-HSPA9 | This paper | shRNA target sequence: CGTGCTCAATTTGAAGGGATT |
|
| Transfected construct (Homo sapiens) | sh-HSP60 | This paper | shRNA target sequence: CCTGCTCTTGAAATTGCCAAT |
|
| Transfected construct (Homo sapiens) | sh-MIA40 | This paper | shRNA target sequence: TCTTGACATCTTGACATATAC |
|
| Transfected construct (Homo sapiens) | sh-TIM9 | This paper | shRNA target sequence: GCTTGGTCACTTGATTAGAAA |
|
| Transfected construct (Homo sapiens) | sh-TIM22 | This paper | shRNA target sequence: GCTTTGACCCTAAGGATCCTT |
|
| Transfected construct (Homo sapiens) | sh-OXA1L | This paper | shRNA target sequence: CGAATCAGAGAGGCCAAGTTA |
|
| Transfected construct (Homo sapiens) | sh-BCS1L | This paper | shRNA target sequence: CGTCCAGGAATTCATCGATAA |
|
| Transfected construct (Homo sapiens) | sh-MOK #1 | This paper | shRNA target sequence: CTGGTTCTCTTGCAC TAATAT |
|
| Transfected construct (Homo sapiens) | sh-MOK #2 | This paper | shRNA target sequence: ACCTCTACTAACAACCAATTT |
|
| Transfected construct (Homo sapiens) | sh-ATAD3A #1 | This paper | shRNA target sequence: CATCAATGAGATGGTCCACTT |
|
| Transfected construct (Homo sapiens) | sh-ATAD3A #2 | This paper | shRNA target sequence: CAAGGACAAATGGAGCAACTT |
|
| Transfected construct (Homo sapiens) | sg-MOK KO #1 | This paper | PEP-KO with gRNA sequence: GTACCAGTTATGTAAGTCCC | |
| Transfected construct (Homo sapiens) | sg-MOK KO #2 | This paper | PEP-KO with gRNA sequence: GCAATTGGCAAAATAGGAGA | |
| Transfected construct (Homo sapiens) | sg-BMP2K KI #1 | This paper | PEP-KI with gRNA sequence: GAAATGGAGCAGCACCAAAT | |
| Transfected construct (Homo sapiens) | sg-BMP2K KI #2 | This paper | PEP-KI with gRNA sequence: TAAACAGTAGATACTTCTGA | |
| Transfected construct (Homo sapiens) | sg-MOK KI #1 | This paper | PEP-KI with gRNA sequence: TCTTCCGCCTTTCCGCACTA | |
| Transfected construct (Homo sapiens) | sg-MOK KI #2 | This paper | PEP-KI with gRNA sequence: CACCGTCGTCTCGACTTCGG | |
| Antibody | Mouse monoclonal anti-alpha 1 Sodium Potassium ATPase antibody | Abcam | Cat# ab7671, RRID:AB_306023 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-GM130 antibody | BD Biosciences | Cat# 610823, RRID:AB_398142 | IF (1:1000) |
| Antibody | Rabbit polyclonal anti-UTP25 antibody | Dr. Jinrong Peng (Zhejiang University) | IF (1:200) | |
| Antibody | Rabbit polyclonal anti-Lamin A/C (H-110) antibody | Santa Cruz Biotechnology | Cat# sc-20681, RRID:AB_648154 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-Lamin A/C (636) antibody | Santa Cruz Biotechnology | Cat# sc-7292, RRID:AB_627875 | IF (1:1000) |
| Antibody | Rabbit monoclonal anti-Catalase (D4P7B) antibody | Cell Signaling Technology | Cat# 12980, RRID:AB_2798079 | IF (1:100) |
| Antibody | Rabbit polyclonal anti-Pericentrin antibody | Covance | Cat# PRB-432C-200, RRID:AB_291635 | IF (1:500) |
| Antibody | Rabbit monoclonal anti-EEA1 (C45B10) antibody | Cell Signaling Technology | Cat# 3288, RRID:AB_2096811 | IF (1:100) |
| Antibody | Rabbit monoclonal anti-TOM20 (F-10) antibody | Santa Cruz Biotechnology | Cat# sc-17764, RRID:AB_628381 | IF (1:1000) |
| Antibody | Mouse polyclonal anti-TOM20 (FL-145) antibody | Santa Cruz Biotechnology | Cat# sc-11415, RRID:AB_2207533 | IF (1:1000) |
| Antibody | Rabbit monoclonal anti-HSP60 (D6F1) antibody | Cell Signaling Technology | Cat# 46611, RRID:AB_2799305 | WB (1:1000), IF (1:500) |
| Antibody | Mouse monoclonal anti-ENDOG (B-2) antibody | Santa Cruz Biotechnology | Cat# sc-365359, RRID:AB_10843802 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-MT-CO2 antibody | Abcam | Cat# ab110258, RRID:AB_10887758 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-LAMP1 antibody | Santa Cruz Biotechnology | Cat# sc-20011, RRID:AB_626853 | IF (1:500) |
| Antibody | Mouse monoclonal anti-HSP90 antibody | BD Biosciences | Cat# 610418, RRID:AB_397798 | WB (1:5000) |
| Antibody | Rabbit monoclonal anti-pErk1/2 (Thr202/Tyr204) antibody | Cell Signaling Technology | Cat# 4370, RRID:AB_2315112 | WB (1:2000) |
| Antibody | Rabbit monoclonal anti-Thiophosphate ester antibody | Abcam | Cat# ab133473, RRID:AB_2737094 | WB (1:5000) |
| Antibody | Rabbit monoclonal anti-PARP (46D11) antibody | Cell Signaling Technology | Cat# 9532, RRID:AB_659884 | WB (1:2000) |
| Antibody | Rabbit polyclonal anti-RPS6KA6 antibody | Sigma-Aldrich | Cat# HPA002852, RRID:AB_1079854 | IF (1:100) |
| Antibody | Rabbit polyclonal anti-MOK antibody | Sigma-Aldrich | Cat# HPA027292, RRID:AB_10600989 | WB (1:1000) |
| Antibody | Mouse monoclonal ANTI-FLAG M2 antibody | Sigma-Aldrich | Cat# F3165, RRID:AB_259529 | IF (1:1000) |
| Antibody | Rabbit monoclonal anti-DYKDDDDK Tag (D6W5B) antibody | Cell Signaling Technology | Cat# 14793, RRID:AB_2572291 | IF (1:500) |
| Antibody | Mouse monoclonal anti-Flag M2-Peroxidase-HRP conjugated antibody | Sigma-Aldrich | Cat# A8592, RRID:AB_439702 | WB (1:5000) |
| Antibody | Rabbit monoclonal anti-HA-Tag (C29F4) antibody | Cell Signaling Technology | Cat# 3724, RRID:AB_1549585 | IF (1:500) |
| Antibody | Mouse monoclonal anti-Myc-Tag (9B11) antibody | Cell Signaling Technology | Cat# 2276, RRID:AB_331783 | IF (1:500) |
| Antibody | Rabbit polyclonal anti-GFP antibody | Abcam | Cat# ab6556, RRID:AB_305564 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-β-actin antibody | Proteintech | Cat# 66009–1-Ig, RRID:AB_2687938 | WB (1:5000) |
| Antibody | Mouse monoclonal anti-Tubulin (clone B5-1-2) antibody | Sigma-Aldrich | Cat# T6074, RRID:AB_477582 | WB (1:5000), IF (1:1000) |
| Antibody | Mouse monoclonal anti- γ-Tubulin (clone GTU88) antibody | Sigma-Aldrich | Cat# T5326, RRID:AB_532292 | IF (1:500) |
| Antibody | Goat polyclonal anti-Rabbit IgG(H + L)-Alexa Fluor 488 conjugated antibody | Thermo Fisher Scientific | Cat# A-11034, RRID:AB_2576217 | IF (1:1000) |
| Antibody | Goat polyclonal anti-Mouse IgG(H + L)-Alexa Fluor 488 conjugated antibody | Thermo Fisher Scientific | Cat# A-11029, RRID:AB_2534088 | IF (1:1000) |
| Antibody | Goat polyclonal anti-Rabbit IgG(H + L)-Alexa Fluor 594 conjugated antibody | Thermo Fisher Scientific | Cat# A-11037, RRID:AB_2534095 | IF (1:1000) |
| Antibody | Goat polyclonal anti-Mouse IgG(H + L)-Alexa Fluor 594 conjugated antibody | Thermo Fisher Scientific | Cat# A-11032, RRID:AB_2534091 | IF (1:1000) |
| Antibody | Goat polyclonal anti-Rabbit IgG(H + L)-Alexa Fluor 647 conjugated antibody | Thermo Fisher Scientific | Cat# A-21244, RRID:AB_2535812 | IF (1:1000) |
| Sequence-based reagent | TOM20 RT-F | This paper | AGGGCGTAGACCATCTGACA | |
| Sequence-based reagent | TOM20 RT-R | This paper | TTCAGCCAAGCTCTGAGCAC | |
| Sequence-based reagent | TOM70 RT-F | This paper | AGACGTGCAAAAGCCCATGA | |
| Sequence-based reagent | TOM70 RT-R | This paper | AAGCATGGGCTGGGAAATGA | |
| Sequence-based reagent | TIM17A RT-F | This paper | GGGAGGGCTGTTTTCCATGA | |
| Sequence-based reagent | TIM17A RT-R | This paper | GGAGGGGTCTTCTGCAAACT | |
| Sequence-based reagent | TIM50 RT-F | This paper | TGCACGAGGTTGGCGA | |
| Sequence-based reagent | TIM50 RT-R | This paper | TGTATGTCCGGCGCAACTG | |
| Sequence-based reagent | TIM23 RT-F | This paper | AGGGGCACTTTGGGCTAATAC | |
| Sequence-based reagent | TIM23 RT-R | This paper | TATCCCTCGAAGACCACCTGT | |
| Sequence-based reagent | HSPA9 RT-F | This paper | CCTACGGCCTGGACAAGAAG | |
| Sequence-based reagent | HSPA9 RT-R | This paper | CTTGTGCTTGCGCTTGAACT | |
| Sequence-based reagent | HSP60 RT-F | This paper | CTTTTAGCCGATGCTGTGGC | |
| Sequence-based reagent | HSP60 RT-R | This paper | TTGGCTATAGAGCGTGCCAG | |
| Sequence-based reagent | MIA40 RT-F | This paper | CTATTGCCGGCAGGAAGGG | |
| Sequence-based reagent | MIA40 RT-R | This paper | GGCATGGGCAGTTCCAGTTA | |
| Sequence-based reagent | TIM9 RT-F | This paper | ACAGAGACCTGCTTTTTGGACT | |
| Sequence-based reagent | TIM9 RT-R | This paper | GCCAGGGCTTCATTCTGCTG | |
| Sequence-based reagent | TIM21 RT-F | This paper | CCTGAGACAGCGGGTTCC | |
| Sequence-based reagent | TIM21 RT-R | This paper | AAGACAAATCCTCCCACGCA | |
| Sequence-based reagent | OXA1L RT-F | This paper | CTCGCAATGGCTTGGGAAAC | |
| Sequence-based reagent | OXA1L RT-R | This paper | CTCAGGTACTGCTGTGGGTG | |
| Sequence-based reagent | BCS1L RT-F | This paper | ATGGCGTCCCTTTGGCTATC | |
| Sequence-based reagent | BCS1L RT-R | This paper | AGTCGGTCATCAGAGAGGCT | |
| Sequence-based reagent | MOK RT-F | This paper | TGAGCTAATACGAGGGAGAAGA | |
| Sequence-based reagent | MOK RT-R | This paper | TACTCCAGGAAAGAGGGGCT | |
| Sequence-based reagent | ATAD3A RT-F | This paper | GCCTCCTGCTCTTTGTGGAT | |
| Sequence-based reagent | ATAD3A RT-R | This paper | AACTGCTCTGGTTGGTTGCT | |
| Sequence-based reagent | ACTB RT-F | This paper | CTCGCCTTTGCCGATCC | |
| Sequence-based reagent | ACTB RT-R | This paper | GAATCCTTCTGACCCATGCC | |
| Commercial assay or kit | Seahorse XF Cell Mito Stress Test Kit | Agilent Technologies | Cat# 103015-100 | |
| Commercial assay or kit | ATP detection kit | Beyotime Biotechnology | Cat# S0026 | |
| Chemical compound, drug | ProLong Gold Antifade Mountant with DAPI | Thermo Fisher Scientific | Cat# P36931 | |
| Chemical compound, drug | Alexa Fluor 488 phalloidin | Thermo Fisher Scientific | Cat# A12379 | IF (1:1000) |
| Chemical compound, drug | MitoTracker Green FM | Thermo Fisher Scientific | Cat# M7514 | |
| Chemical compound, drug | CM-H2DCFDA | Thermo Fisher Scientific | Cat# C6827 | |
| Chemical compound, drug | MitoTracker Red CMXRos | Thermo Fisher Scientific | Cat# M7512 | |
| Chemical compound, drug | Pfu Turbo DNA Polymerase | Agilent Technologies | Cat# 600252-52 | |
| Chemical compound, drug | Streptavidin Resin | Agilent Technologies | Cat# 240105--51 | |
| Chemical compound, drug | 1,6-Hexanediol | Sigma-Aldrich | Cat# 8043081000 | |
| Chemical compound, drug | EDTA-free Protease Inhibitor Cocktail | Sigma-Aldrich | Cat# S8830 | |
| Chemical compound, drug | ANTI-FLAG M2 agarose beads | Sigma-Aldrich | Cat# F2426 | |
| Chemical compound, drug | Polybrene | Sigma-Aldrich | Cat# 107689 | |
| Chemical compound, drug | Diamide | Sigma-Aldrich | Cat# D3648 | |
| Chemical compound, drug | Biotin | Sigma-Aldrich | Cat# B4501 | |
| Chemical compound, drug | Vacuolin-1 | Sigma-Aldrich | Cat# V7139 | |
| Chemical compound, drug | Digitonin | Sangon Biotech | Cat# DG1152 | |
| Chemical compound, drug | ATP-γ-S | Abcam | Cat# ab138911 | |
| Chemical compound, drug | p-Nitrobenzyl mesylate (PNBM) | Abcam | Cat# ab138910 | |
| Software, algorithm | GraphPad Prism | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | Image-Pro Plus 6.0 | Image-Pro Plus | RRID:SCR_016879 | |
| Software, algorithm | VENNY2.1 | https://bioinfogp.cnb.csic.es/tools/venny/index.html | Coverage of the kinome by KA and databases were analyzed by VENNY2.1 | |
| Software, algorithm | KinMap | PMID:28056780 | Kinome Atlas were presented on kinome tree using KinMap The localization and enrichment levels were reflected by colors and sizes of circles | |
| Software, algorithm | SMART | http://smart.embl.de/ | Domain architecture of each kinase is analyzed by SMART | |
| Software, algorithm | IUPred2A | https://iupred2a.elte.hu/ | Intrinsic disorder tendency is predicted by IUPred2A | |
| Software, algorithm | PLAAC | http://plaac.wi.mit.edu/ | Prion-like domains (PrD.like, red) of each kinase are predicted by PLAAC |